Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse

https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html#

Bypass censorship by sharing this link:

New

https://www.afinalwarning.com/495900.html Copy URL 30KViews

Image: Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse

(Natural News) America as we know it is over. President Trump is the last president of the United States of America. Fake president Joe Biden wasn’t elected by the people and isn’t a real president, so his fake regime doesn’t count.

Beyond all the politics and cyber warfare and criminal vote fraud carried out by Democrats, what is the real root cause of the fall of America? As I explain in today’s podcast, it really comes down to mass mental illness.

Over half the people in America are mentally poisoned to the point of clinical insanity, and it is these people who attempt to run the government, the fake news outlets, the CDC and public schools, all like some twisted scene out of Idiocracy where even the Secretary of Education is a complete moron.

We’ve already passed the Idiocracy tipping point in America, of course. Fake White House press secretary Jen Psaki is a moron. Fake president Joe Biden has advanced dementia. None of the Democrats in the U.S. Senate can recognize reality anymore, and they function almost entirely as brainwashed bio-puppets who do whatever they’re told. (Which is what NPCs do, of course.) Meanwhile, the people who voted for Biden suffer from the mental illness / cult brainwashing of “progressivism” which is rooted in irrationality, learned hatred and denial of reality.

But what caused all this mass mental illness? It’s not difficult to identify the vectors of the poisoning:

When you put all this together, you realize that a majority of Americans are now cognitively poisoned beyond the point of rationality. Recently, a woman who ran out of hair spray spread Gorilla Glue across her entire head and then couldn’t figure out why the glue wouldn’t wash out in the shower. But that’s not the mass mental illness I’m referring to.

In response to this, people donated $15,000 to her GoFundMe account, and nearly 700,000 followers joined her on Instagram, so the woman has now hired a manager. This is the mass mental illness of the population being demonstrated, where people are attracted to insanity and stupidity and end up supporting it. It really is like a scene ripped right out of Idiocracy.

Here’s a short Brighteon video explaining this fascinating demonstration of total madness and stupidity. It’s too bad Democrats won’t try to use Gorilla Glue as lipstick, so they might glue all their lips shut and stop filling the world with stupidity:

https://www.brighteon.com/embed/88d31489-0456-4e2f-b2e3-c1cdfce48972

In today’s important Situation Update, I reveal why America is over and how the globalists will likely succeed in mass murdering six billion people. It doesn’t look like a process we can stop.

It’s also apparent that the masses are either too stupid or too insane to have any idea what’s happening to them. The Bill Gates effort to mass murder six billion people won’t be difficult for globalists to achieve. Do you really think “Gorilla Glue girl” has any clue that the global depopulation agenda is targeting people like her, whom globalists label “useless eaters?”

Meanwhile, Big Tech censors intelligent people like Sherri Tenpenny or Dr. Joseph Mercola, while promoting the content of idiots who use industrial glue as a hair gel. What’s next? Will she use Gorilla Glue as a food thickener in her macaroni and cheese, and then wonder why she has a stomach ache?

Yet her story isn’t unusual anymore. People are insane everywhere, and that includes US senators, so-called “journalists” and even the “authorities” at the FDA or CDC.

We are no longer living in a world ruled by rationality, morality and clear thinking. The world has collapsed into insanity, immorality and demonism.

This is why America as we know it is over. The genocidal globalists will “win” in their effort to slaughter billions. But after the coming collapse and mass genocide, there will be a “next society” for the survivors, most of whom will be preppers and anti-vaxxers because that’s who is prepared to survive the global culling.

We must all prepare to survive the mass culling and then contribute to the society that emerges on the other side.

Also, there will be no more traffic jams or difficulty finding parking, just fyi.

Brighteon.com/230c068b-2e3b-44e4-9f4f-6f797a1d3b46

https://www.brighteon.com/embed/230c068b-2e3b-44e4-9f4f-6f797a1d3b46

Hear each day’s new podcast at:

https://www.brighteon.com/channels/hrreportPrevious :Natural News launches TOR browser (.onion) website to bring natural health and nutrition knowledge to the dark webNext : Situation Update, Feb. 11th – Environmental groups call out Bill Gates for insanely dangerous global terraforming scheme 30KViews

Receive Our Free Email Newsletter

Get independent news alerts on natural cures, food lab tests, cannabis medicine, science, robotics, drones, privacy and more. https://www.naturalnews.com/Include-ReaderRegistration-2019-Subscribe-Form-UnderArticle.html

More news on brain function

Reducing your sugar intake will help improve your sleep quality and food choicesStudy: Walking slowly may be a sign of “accelerated aging” and that you’re more likely to get sick later in lifeHere’s how you can boost your dopamine levels naturallySituation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapseStudy: Trans fats linked to poor brain health and greater risk of dementia and Alzheimer’sA diet high in trans fats linked to a significantly higher risk of dementia among the elderlyCan abdominal pain affect brain function?Musk mallow seeds can protect the brain against degeneration caused by fluoride toxicityCompounds from two Nigerian vegetables found to inhibit enzymes implicated in neurodegenerative diseasesStudy explains how a chemical from Japanese cornel may help treat Alzheimer’s disease

About the author: Mike Adams (aka the “Health Ranger“) is a best selling author (#1 best selling science book on Amazon.com called “Food Forensics“), an environmental scientist, a patent holder for a cesium radioactive isotope elimination invention, a multiple award winner for outstanding journalism, a science news publisher and influential commentator on topics ranging from science and medicine to culture and politics. Follow his videos, podcasts, websites and science projects at the links below.

Mike Adams serves as the founding editor of NaturalNews.com and the lab science director of an internationally accredited (ISO 17025) analytical laboratory known as CWC Labs. There, he was awarded a Certificate of Excellence for achieving extremely high accuracy in the analysis of toxic elements in unknown water samples using ICP-MS instrumentation. Adams is also highly proficient in running liquid chromatography, ion chromatography and mass spectrometry time-of-flight analytical instrumentation. He has also achieved numerous laboratory breakthroughs in the programming of automated liquid handling robots for sample preparation and external standards prep.

The U.S. patent office has awarded Mike Adams patent NO. US 9526751 B2 for the invention of “Cesium Eliminator,” a lifesaving invention that removes up to 95% of radioactive cesium from the human digestive tract. Adams has pledged to donate full patent licensing rights to any state or national government that needs to manufacture the product to save human lives in the aftermath of a nuclear accident, disaster, act of war or act of terrorism. He has also stockpiled 10,000 kg of raw material to manufacture Cesium Eliminator in a Texas warehouse, and plans to donate the finished product to help save lives in Texas when the next nuclear event occurs. No independent scientist in the world has done more research on the removal of radioactive elements from the human digestive tract.

Adams is a person of color whose ancestors include Africans and American Indians. He is of Native American heritage, which he credits as inspiring his “Health Ranger” passion for protecting life and nature against the destruction caused by chemicals, heavy metals and other forms of pollution.

Adams is the author of the world’s first book that published ICP-MS heavy metals analysis results for foods, dietary supplements, pet food, spices and fast food. The book is entitled Food Forensics and is published by BenBella Books.

In his laboratory research, Adams has made numerous food safety breakthroughs such as revealing rice protein products imported from Asia to be contaminated with toxic heavy metals like lead, cadmium and tungsten. Adams was the first food science researcher to document high levels of tungsten in superfoods. He also discovered over 11 ppm lead in imported mangosteen powder, and led an industry-wide voluntary agreement to limit heavy metals in rice protein products.

In addition to his lab work, Adams is also the (non-paid) executive director of the non-profit Consumer Wellness Center (CWC), an organization that redirects 100% of its donations receipts to grant programs that teach children and women how to grow their own food or vastly improve their nutrition. Through the non-profit CWC, Adams also launched Nutrition Rescue, a program that donates essential vitamins to people in need. Click here to see some of the CWC success stories.

With a background in science and software technology, Adams is the original founder of the email newsletter technology company known as Arial Software. Using his technical experience combined with his love for natural health, Adams developed and deployed the content management system currently driving NaturalNews.com. He also engineered the high-level statistical algorithms that power SCIENCE.naturalnews.com, a massive research resource featuring over 10 million scientific studies.

Adams is well known for his incredibly popular consumer activism video blowing the lid on fake blueberries used throughout the food supply. He has also exposed “strange fibers” found in Chicken McNuggets, fake academic credentials of so-called health “gurus,” dangerous “detox” products imported as battery acid and sold for oral consumption, fake acai berry scams, the California raw milk raids, the vaccine research fraud revealed by industry whistleblowers and many other topics.

Adams has also helped defend the rights of home gardeners and protect the medical freedom rights of parents. Adams is widely recognized to have made a remarkable global impact on issues like GMOs, vaccines, nutrition therapies, human consciousness.

In addition to his activism, Adams is an accomplished musician who has released over fifteen popular songs covering a variety of activism topics.

Click here to read a more detailed bio on Mike Adams, the Health Ranger, at HealthRanger.com.

Find more science, news, commentary and inventions from the Health Ranger at:

Brighteon.com:
Brighteon.com/channel/hrreport

Diaspora: (uncensored social network)
Share.NaturalNews.com

GAB:
GAB.com/healthranger

Podcasts:
HealthRangerReport.com

Online store:
HealthRangerStore.com

#1 Bestselling Science Book Food Forensics:
FoodForensics.com

iTunes:
itunes.apple.com/us/podcast/the-health-ranger-report/id1063165791

SoundCloud:
Soundcloud.com/healthranger

Health Ranger’s science lab
CWClabs.com

Health Ranger bio
HealthRanger.com
TruthWiki.org

Search engine:
Webseed.com

Disqus

https://disqus.com/embed/comments/?base=default&f=naturalnews&t_i=nn%3A81615&t_u=https%3A%2F%2Fwww.naturalnews.com%2F2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html&t_d=Situation%20Update%2C%20Feb.%2010th%20%E2%80%93%20How%20America%20ends%3A%20Mass%20mental%20poisoning%20triggers%20tipping%20point%20of%20collapse&t_t=Situation%20Update%2C%20Feb.%2010th%20%E2%80%93%20How%20America%20ends%3A%20Mass%20mental%20poisoning%20triggers%20tipping%20point%20of%20collapse&s_o=default#version=4ce792797f4c10a96525509c741bcf5f

Take Action: Support Natural News by linking to this article from your website

Permalink to this article:
https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html

Embed article link: (copy HTML code below):
<a href=”https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html”>Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse</a>

Reprinting this article:

Non-commercial use OK, cite NaturalNews.com with clickable link.

Follow Natural News on Diaspora, AllSocial, USA.Life, Parler, MeWe, and GAB Most Viewed Articles Today Week Month Year

Reference Information

Science.NaturalNews.com
Conduct powerful scientific research in mere seconds for your book, blog, website article or news report.

NaturalPedia.com
A free online encyclopedia of natural health knowledge from the industry’s top authors and writers.

HealingFoodReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of foods.

HerbReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of herbs.

SupplementReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of supplements.

NutrientReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of nutrients.

HonestFoodGuide.org
This free to download food guide offers genuine nutritional information, not watered-down information designed to boost the sale of milk, beef and grains.

Advertise with NaturalNews… Natural News Wire (Sponsored Content)

Advertise with NaturalNews…

Science.News
Science News & Studies

Medicine.News
Medicine News and Information

Food.News
Food News & Studies

Health.News
Health News & Studies

Herbs.News
Herbs News & Information

Pollution.News
Pollution News & Studies

Cancer.News
Cancer News & Studies

Climate.News
Climate News & Studies

Survival.News
Survival News & Information

Gear.News
Gear News & Information

Glitch.News
News covering technology, stocks, hackers, and more Read Archived NaturalNews StoriesNaturalNews.com

Natural News Toolbar
Privacy Policy
Terms of Use
About Us
Contact Us/Feedback
Write for Natural News
Media Information
Advertise Information Follow Us

Email Newsletter
Brighteon.Social
MeWe
GAB
Diaspora
USA.Life
Parler
RSS

Apple iOS app
Android app on Google Play
eTrust Pro Certified

This site is part of the Natural News Network © 2019 All Rights Reserved. Privacy | Terms All content posted on this site is commentary or opinion and is protected under Free Speech. Truth Publishing International, LTD. is not responsible for content written by contributing authors. The information on this site is provided for educational and entertainment purposes only. It is not intended as a substitute for professional advice of any kind. Truth Publishing assumes no responsibility for the use or misuse of this material. Your use of this website indicates your agreement to these terms and those published here. All trademarks, registered trademarks and servicemarks mentioned on this site are the property of their respective owners. Get the world’s best natural health newsletter delivered straight to your inbox.

x

By con

Watch – Doctor Admits Masks Don’t Work: “All Viruses Can Get Through”

by Adan Salazar February 1st 2021, 1:06 pm ‘I wear a mask so people don’t think I don’t care about them, but I don’t wear a mask because they work.’Image Credit:TwitterShareFund the InfoWar. Donate Now!Keep up to date with our latest:EmailSign Up NowHave an important tip? Let us know.Email us here.

A medical doctor’s lecture explaining face masks aren’t effective at blocking viruses has gone viral.

In the message, a member of America’s Frontline Doctors, Dr. Richard Urso, admits masks block little if any microscopic virus particles, contrary to what mainline health experts have been telling the public.

https://platform.twitter.com/embed/Tweet.html?dnt=true&embedId=twitter-widget-1&frame=false&hideCard=false&hideThread=false&id=1355276143159517184&lang=en&origin=https%3A%2F%2Fwww.infowars.com%2Fposts%2Fwatch-doctor-admits-masks-dont-work-all-viruses-can-get-through%2F&theme=light&widgetsVersion=889aa01%3A1612811843556&width=500px

“We know what works — these don’t work against viruses. Regular masks don’t work. That’s simply what it is,” Urso explains.

“It has nothing to do with Covid. Covid doesn’t even factor into the equation, because for years we’ve been looking at these issues.”

The Texas-based ophthalmologist goes on to explain there are more protective methods which would be more effective, but the N-95 masks recommended to the public still allow virus particles to pass.

“So, they have these spacesuits, they’re called ‘PAPRs,’ they’re incredibly effective, they filter viruses down to .01. Basically we have materials like N-99, N-100, but N-95… only five percent of airborne particles can get through, but all viruses can get through period.”

“Now do they get through? No, it’s just like a chainlink fence. When you throw sand at a chainlink fence not all the sand gets through.”

“So, I think the best example I can say is the reason we wear masks and the reason I wear a mask is because the fear is so massive in this country. I wear a mask so people don’t think I don’t care about them, but I don’t wear a mask because they work.”

Dr. Urso’s message is spreading as NIAID Director Anthony Fauci has once again flip-flopped on masks, at first claiming last week that it was “common sense” to wear two, or even up to three masks. Over the weekend, however, Dr. Fauci claimed there was “no data” to indicate that wearing two masks “would make a difference.” https://platform.twitter.com/embed/Tweet.html?dnt=true&embedId=twitter-widget-2&frame=false&hideCard=false&hideThread=false&id=1355991619225448450&lang=en&origin=https%3A%2F%2Fwww.infowars.com%2Fposts%2Fwatch-doctor-admits-masks-dont-work-all-viruses-can-get-through%2F&theme=light&widgetsVersion=889aa01%3A1612811843556&width=500px


Follow the author on Gab: https://gab.ai/adansalazar
On Twitter: https://platform.twitter.com/widgets/follow_button.6e189c4f2b6d88c453045806323cdcf3.en.html#dnt=true&id=twitter-widget-0&lang=en&screen_name=AdanSalazarWins&show_count=false&show_screen_name=true&size=m&time=1613023157347
On Parler: https://parler.com/profile/adansalazar/
On Facebook: https://www.facebook.com/adan.salazar.735
On Minds: https://www.minds.com/adan_infowars https://api.banned.video/embed/60176d089942cd18bc5c2190

BOMBSHELL: MAJOR GOVERNMENTS SAY COVID-19 VACCINE A FRAUD

COVID 19 – Evidence Of Global Fraud, POSTED BY: IAIN NOVEMBER 16, 2020

COVID 19 – Evidence Of Global Fraud

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery.  Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

Identification of What Exactly?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.

The WHO’s Laboratory testing guidance states:

“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:

“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

It is not clear that SARS-CoV-2 is a human virus capable of causing widespread illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

Voyage Of Discovery

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”

E Gene target sequence

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

Isolate Nothing

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

“PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

Testing For Nothing

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

  • RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
  • S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
  • E gene (Orf1ab) – small membrane protein used in viral assembly
  • N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and reverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

Conclusive Fraud

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised .

Prince Charles telling us to embrace the Great Reset

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

01/15/21

WHO: No Guarantee COVID Vaccines Will Prevent People From Being Infected

At a virtual press conference held by the World Health Organization officials warned there is no clear evidence COVID-19 vaccines are effective at preventing asymptomatic infection and transmission.

Story at-a-glance:

  • The World Health Organization (WHO) warned there is no guarantee that COVID-19 vaccines will prevent people from being infected with the SARS-CoV-2 virus and transmitting it to other people.
  • Vaccinated persons still need to mask and social distance because they could be able to spread the new coronavirus to others without knowing it, according to WHO and U.S. health officials.
  • As with measles and polio, there is no guarantee of eliminating the SARS-CoV-2 virus through mass vaccination programs.
  • There is a possibility the U.S. government will introduce “COVID-19 vaccine passports” and that some local governments and businesses will make COVID-19 vaccines mandatory, including in schools.
  • Technology companies have been working on creating a digital certificate, which contains personal medical information giving evidence that an individual has been vaccinated and which can be used as a screening tool by employers and businesses.

At a virtual press conference held by the WHO Dec. 28, 2020, officials warned there is no guarantee that COVID-19 vaccines will prevent people from being infected with the SARS-CoV-2 virus and transmitting it to other people.

In a New Year’s Day interview with Newsweek, Dr. Anthony Fauci, director of the National Institute of Allergy and Infectious Diseases, reinforced the WHO’s admission that health officials do not know if COVID-19 vaccines prevent infection or if people can spread the virus to others after getting vaccinated.

According to U.S. and WHO health officials, vaccinated persons still need to mask and social distance because they could be able to spread the new coronavirus to others without knowing it.

Although the U.S. Food and Drug Administration granted Emergency Use Authorization in December 2020 for Pfizer/BioNTech and Moderna to release their experimental mRNA vaccines for use in the U.S., the companies only provided evidence from clinical trials to demonstrate that, compared to unvaccinated trial participants, their vaccines prevented more mild to severe COVID-19 disease symptoms in vaccinated participants.

The companies did not investigate whether the vaccines prevent people from becoming asymptomatically infected with the SARS-CoV-2 virus and/or transmitting it to other people.

COVID-19 vaccines designed to prevent severe disease

According to WHO officials, while it appears the vaccines can prevent clinically symptomatic COVID-19 clinical disease, there is no clear evidence COVID-19 vaccines are effective at preventing asymptomatic infection and transmission. During the press conference, WHO chief scientist and pediatrician Dr. Soumya Swaminathan said:

“We continue to wait for more results from the vaccine trials to really understand whether the vaccines, apart from preventing symptomatic disease and severe disease and deaths, whether they’re also going to reduce infection or prevent people from getting infected with the virus, then from passing it on or transmitting it to other people.

I don’t believe we have the evidence on any of the vaccines to be confident that it’s going to prevent people from actually getting the infection and therefore being able to pass it on.”

Swaminathan said the COVID-19 vaccine was designed to first prevent symptomatic disease, severe disease and deaths. Dr. Mark Ryan, MPH, who is executive director of the WHO Health Emergencies Program, agreed with Swaminathan and added:

“So the first primary objective is to decrease the impact the disease is having on people’s lives and, therefore, that will be a major step forward in bringing the world back to some kind of normal.

The second phase is then looking at how will this vaccine affect transmission. We just don’t know enough yet about length of protection and other things to be absolutely able to predict that, but we should be able to get good control of the virus.”

SARS-CoV-2 eradication via mass vaccination is a ‘moonshot’

Ryan also pointed out that the decision by WHO to try to eradicate the SARS-CoV-2 virus “requires a much higher degree of efficiency and effectiveness in the vaccination program and the other control measures” and that it is likely the new coronavirus will “become another endemic virus, a virus that will remain somewhat of a threat but a very low level threat in the context of an effective vaccination program.”

Ryan cautioned that, like with measles and polio, there is no guarantee of eliminating the SARS-CoV-2 virus through mass vaccination programs. He said:

“The existence of a vaccine even at high efficacy is no guarantee of eliminating or eradicating an infectious disease. That’s a very high bar for us to be able to get over. First, we have to focus on saving lives, getting good control of this epidemic, and then we will deal with the moonshot of potentially being able to eliminate or eradicate this virus.”

Azar says get vaccinated but still mask up

In a Dec.  22, 2020 interview, HHS Secretary Alex Azar told Fox News that the current “consensus” among health officials is that people who get two doses of COVID-19 vaccine should still mask up and practice social distancing. He said:

“We’re still studying some fundamental scientific questions though, such as, once you’ve been vaccinated, do you still need to wear a mask to protect others, could you still be carrying the virus even though you’re protected from it …

“If you’re getting vaccinated right now, still social distance, still wear a mask, but all these [recommendations] have to be data and science-driven, so we’re working to generate the data there so that as we go forward, we’ll be able to advise people on a foundation of data.”

COVID-19 vaccine passports and mandates may be coming

In an interview on CNN in early April 2020 when most states were in some form of a coronavirus lockdown, Fauci told Alyson Camerota, “It’s very likely that there are a large number of people out there that have been infected, have been asymptomatic, and did not know they were infected.”

Eight months later, on New Year’s Day 2021, Fauci told Newsweek that in his role as the new administration’s chief medical adviser, there is a possibility the federal government will eventually introduce “COVID-19 vaccine passports” and that some city, county or state governments and businesses will make COVID-19 vaccines mandatory, including in schools.

“Everything will be on the table,” Fauci declared. A week earlier, Fauci told The New York Times that between 70% and 90% of the U.S. population would need to get COVID-19 vaccinations in order for the country to reach vaccine-acquired herd immunity. He explained why he has continued to shift the “herd immunity” goal post over the past year:

“When polls said only about half of all Americans would take a vaccine, I was saying herd immunity would take 70 to 75 percent. Then, when newer surveys said 60 percent or more would take it, I thought, ‘I can nudge this up a bit,’ so I went to 80, 85 … We really don’t know what the real number is. I think the real range is somewhere between 70 to 90 percent. But, I’m not going to say 90 percent.”

Even as Fauci discussed vaccine passports and mandates in Newsweek, he admitted that proving that COVID-19 vaccines do more than prevent clinical disease but also block infection and transmission has been elusive. He emphasized that persons who get vaccinated still must wear masks:

“We do not know if the vaccines that prevent clinical disease also prevent infection. They very well might, but we have not proven that yet … That’s the reason I keep saying that even though you get vaccinated, we should not eliminate, at all, public health measures like wearing masks because we don’t know yet what the effect [of the vaccine] is on transmissibility.”

Fauci added, “We don’t know what we don’t know.”

Immunity passports: suggested soon after the pandemic began

Government health officials in Israel are getting ready to issue a COVID-19 “green passport” to citizens who have received two COVID-19 shots, which will exempt them from travel restrictions and testing for infection with the SARS-CoV-2 virus or being required to quarantine after exposure to an infected person.

Technology companies have been working on creating a digital certificate, which contains personal medical information giving evidence that an individual has been vaccinated and can be used as a screening tool by employers, businesses and owners or operators of services and public venues, such as airlinestheme parksconcert halls, hotels and other places where people gather in groups with other people.

Immediately after the coronavirus pandemic was declared by the WHO last winter, Silicon Valley businessman Bill Gates began talking about the need for issuing digital certificates proving immunity to the virus and, once a COVID-19 vaccine becomes available, proof of vaccination.

In a comment posted on Reddit in March 2020, Gates said, “Eventually we will have some digital certificates to show who has recovered or been tested recently or when we have a vaccine who has received it.”

That same month in a TED Talk, Gates explained how lockdowns and resulting “economic pain” will prevent people from getting naturally acquired immunity to the SARS-CoV-2 virus and that immunity “certificates” will eventually be required. Gates said:

“Now we don’t want to have a lot of recovered people, you know. To be clear, we’re trying through the shutdown in the United States, to not get to one percent of the population infected. We’re well below that today, but with exponentiation you could get past that three million. I believe we will be able to avoid that with having this economic pain.

“Eventually, what we’ll have to have is certificates of who is a recovered person, who’s a vaccinated person, because you don’t want people moving around the world where you’ll have some countries that won’t have it under control, sadly. You don’t want to completely block off the ability for people to go there and come back and move around.”

In an April 9, 2020, interview on National Public Radio, Gates returned to the message that some “social distancing” measures have to stay in place “until we get a vaccine that almost everybody’s had.” He said:

“What I’m saying, what Dr. Anthony Fauci is saying, what some other experts are saying, there’s a great deal of consistency. We’re not sure yet which activities should be resumed, because until we get a vaccine that almost everybody’s had, the risk of a rebound will be there.”

As of Jan. 3, 2021, the CDC had recorded over 20 million COVID-19 cases and nearly 350,000 related deaths.

Lasting immunity after mild, asymptomatic COVID-19 infection

A study was published Dec. 24, 2020, in Science Immunology by scientists from Queen Mary, University of London, in which they analyzed antibody and T cell responses in 136 London health care workers and reported that there was evidence of protective immunity up to four months after mild or asymptomatic COVID-19.

press release issued by the university stated that mild or asymptomatic SARS-CoV-2 infections represent the largest infected group and noted that researchers found T cell responses tended to be higher in those with the classic, defining symptoms of COVID-19, while asymptomatic infection resulted in a weaker T cell immunity than symptomatic infection, but equivalent neutralizing antibody responses. One of the researchers commented:

“Our study of SARS-CoV-2 infection in healthcare workers from London hospitals reveals that four months after infection, around 90 percent of individuals have antibodies to block the virus. Even more encouragingly, in 66 percent of healthcare workers we see levels of these protective antibodies are high and that this robust antibody response is complemented by T cells which we see reacting to various parts of the virus.

“This is good news. It means that if you have been infected there is a good chance that you will have developed antibodies and T cells that may provide some protection if you encounter the virus again.”

Originally published by Mercola.

The views and opinions expressed in this article are those of the authors and do not necessarily reflect the views of Children’s Health Defense.

The Biden Crime Family


Pres Trump is most admired man in America, according to Gallup Polls – sorry Libtards: “Orange Man Bad” is minority opinion
https://www.marketwatch.com/story/donald-trump-breaks-barack-obamas-record-streak-as-americas-most-admired-man-11609254922?mod=MW_article_top_stories

Ukraine releases Documents showing the Biden Crime Family robbed Ukraine People of Millions of Dollars
Ukraine Press Conference Explicitly Ties Hunter & Joe Biden To Corruption
https://www.zerohedge.com/political/ukraine-press-conference-explicitly-ties-hunter-joe-biden-corruption

kiikolkjkfmgboaa

YouTube Press Release in Ukrainian with English Subtitles:  https://www.youtube.com/watch?v=hKDXVo-OKeQ&feature=emb_logo

New Files Released From Ukraine Reveals Biden, Obama Officials Allegedly
Got 17.5 MILLION Dollars Through Racketeering
https://thehill.com/opinion/campaign/463307-solomon-these-once-secret-memos-cast-doubt-on-joe-bidens-ukraine-story

Get Ukraine Docs on Biden from  https://www.scribd.com/user/259237201/JohnSolomon
https://rightwingtribune.com/2019/10/12/new-files-released/
https://www.foxnews.com/politics/documents-heighten-scrutiny-on-biden-ukraine-dealings-indicate-hunter-may-have-made-millions
https://www.breitbart.com/2020-election/2019/09/26/report-hundreds-of-documents-conflict-with-joe-bidens-account-of-why-ukrainian-prosecutor-was-fired/

Ukrainian Lawmaker Says Joe Biden Took $900k from Burisma While Still in Office, Claims To Have Documents Proving It
https://www.westernjournal.com/ukrainian-lawmaker-says-joe-biden-took-900k-burisma-still-office-claims-documents-proving/

The Biden Family also got massive Bribes from China

——– Forwarded Message ——–Subject:
China wired $$$ to Hunter Biden, Hunter wired some to Joe – Joe Biden will be arrested, not inaugurated
Date:  Mon, 28 Dec 2020 18:18:20 -0800
China wired $$$ to Hunter Biden, then Hunter wired $$$ to Joe – Joe Biden will be arrested, not inaugurated

jecbahoepjackhji
Hunter Biden in 2017 sent ‘best wishes’ from ‘entire Biden family’ to China firm chairman, requested $10M wire
https://www.foxnews.com/politics/hunter-biden-letter-chinese-cefc-chairman-wire-request
BIDEN TAPES REVEAL HUNTER AND JOE GUILTY OF SECRET CHINA DEALS!        https://themarshallreport.wordpress.com/2020/12/11/biden-tapes-reveal-hunter-and-joe-guilty-of-secret-china-deals/
Imposter Joe Biden must be arrested, prosecuted and incarcerated for the good of the Republic
https://www.sgtreport.com/2020/12/imposter-joe-biden-must-be-arrested-prosecuted-and-incarcerated-for-the-good-of-the-republic-2/

How Treasury Dept. tracked overseas cash pocketed by Hunter Biden
https://www.washingtontimes.com/news/2020/oct/4/how-treasury-dept-tracked-overseas-cash-pocketed-b/

Senate investigators: New records ‘confirm’ troubling Biden family links to China and Russia
https://www.washingtonexaminer.com/news/senate-investigators-new-records-confirm-troubling-biden-family-links-to-china-and-russia

The Biden Corruption Scandal Isn’t About Hunter, It’s About Joe
https://thefederalist.com/2020/10/19/the-biden-corruption-scandal-isnt-about-hunter-its-about-joe/

hgchjooijbglanhc

Hunter Biden’s addiction is not the issue. Joe Biden’s addiction is: His addiction to power and money.
And it is the evidence of the former vice president’s corruption, and the national security risk our country would face by electing Biden,
that is the story of the MacBook hard drive, not the salacious, verified photographs and videos of Hunter Biden.
Data and emails on Hunter Biden’s Laptop show everything.

And then Ukraine:

Ukraine releases Documents showing the Biden Crime Family robbed Ukraine People of Millions of Dollars
YouTube Press Release in Ukrainian with English Subtitles:  https://www.youtube.com/watch?v=hKDXVo-OKeQ&feature=emb_logo

New Files Released From Ukraine Reveals Biden, Obama Officials Allegedly
Got 17.5 MILLION Dollars Through Racketeering
https://thehill.com/opinion/campaign/463307-solomon-these-once-secret-memos-cast-doubt-on-joe-bidens-ukraine-story

Get Ukraine Docs on Biden from  https://www.scribd.com/user/259237201/JohnSolomon
https://rightwingtribune.com/2019/10/12/new-files-released/
https://www.foxnews.com/politics/documents-heighten-scrutiny-on-biden-ukraine-dealings-indicate-hunter-may-have-made-millions
https://www.breitbart.com/2020-election/2019/09/26/report-hundreds-of-documents-conflict-with-joe-bidens-account-of-why-ukrainian-prosecutor-was-fired/
Ukrainian Lawmaker Says Joe Biden Took $900k from Burisma While Still in Office, Claims To Have Documents Proving It
https://www.westernjournal.com/ukrainian-lawmaker-says-joe-biden-took-900k-burisma-still-office-claims-documents-proving/


The Biden Family also got massive Bribes from China

hitler

——– Forwarded Message ——–Subject:
PA House finds 200,000 bogus votes
Date:  Mon, 28 Dec 2020 17:26:52 -0800

PA House finds 200,000 bogus votes (next AZ, NV, WI, MI, GA)
https://hereistheevidence.com/election-2020/pa-update-records/
https://twitter.com/russdiamond/status/1343622485946880007
https://www.thegatewaypundit.com/2020/12/breaking-pennsylvania-certified-results-president-found-error-error-twice-size-difference-candidates/

After nearly two months, the state of Pennsylvania is found to have certified votes that are in error.
The Pennsylvania House has just uncovered that the certified results in Pennsylvania for President are in error by more than 200,000 votes.
This is more than twice the difference between President Trump and Joe Biden.

Stop the Steal!   https://stopthesteal.us/
Plot to Steal America Video – 17 minute Video
https://www.facebook.com/DonaldTrump/videos/219439113008326

bpgcngnphpkhekeh

Not just Corruption – actually Treason!  
Media Controls Public Opinion and even Censors the President.
Counterfeit Ballots, hacked Dominion Election-counting Software that weights votes more to Biden.
Shredded Ballots, all for Trump
—————————————————————-
Statement on Election Fraud by President Trump – 14 minute Video

https://www.facebook.com/DonaldTrump/videos/436515744393744
————————————————————————–

Watch Security Camera Videos that show the SAME Ballots stuffed into machines over and over again
https://www.thegatewaypundit.com/2020/12/president-trump-retweets-gateway-pundit-video-showing-poll-workers-stuffing-ballots-tabulators-numerous-times-election-night/
——————————————————————————–
Peter Navarro presents his report on Election Fraud
https://www.facebook.com/watch/?v=1723824047794927
36 page Navarro Report of Election Fraud in 6 States
https://www.thegatewaypundit.com/2020/12/theft-thousand-cuts-assistant-president-trump-peter-navarro-produces-report-fraud-2020-election/
https://phibetaiota.net/wp-content/uploads/2020/12/Navarro-Report-Six-Dimensions-Election-Irregularities.pdf
———————————————————————————
Summary of the Voter Fraud by OAN – 1-1/2 minutes

————————————————————————————–
Stop The Steal – 1 minute Video

https://www.facebook.com/DonaldTrump/videos/238598167675214
—————————————————————————————-
Georgia Poll Worker details the Fraud he saw – 2 minute Video

https://www.facebook.com/DonaldTrump/videos/230560558543713
—————————————————————————————
Fight for Trump – Save America, Save the World – 2 minute Video
https://www.facebook.com/153080620724/videos/2849119275359249

migcfghhfiefehin

How to Steal an Election – 1 minute Video
https://streamable.com/8cdi3o
A powerful video laying out the globalist plot to steal the 2020 presidential election starting with the release of the China Virus
went viral over the weekend after President Trump shared it on Twitter.
Twitter suspended the account of @CJTruth, the user who shared the video shortly after President Trump had retweeted it on Sunday.
https://banned.video/watch?id=5fdfdb96222e2d0828f87784

imcmhhbgkfcgpcmc

Dominion software deleted over 2.7 million votes nationwide, switched over 500,000 from Trump to Biden

https://www.naturalnews.com/2020-11-12-trump-bombshell-dominion-software-deleted-votes-switched-biden.html

ohmepboibgeebcjm

Watch Security Camera Videos that show the SAME Ballots stuffed into machines over and over again
https://www.thegatewaypundit.com/2020/12/president-trump-retweets-gateway-pundit-video-showing-poll-workers-stuffing-ballots-tabulators-numerous-times-election-night/
More on Trump’s WINs in Court and with State Legislatures
Listen to President Trump’s latest 6 minute speech
https://www.facebook.com/DonaldTrump/videos/436515744393744/?t=10

Will TRUMP be the NEXT LINCOLN?? Will TRUMP smash the DEEP STATE COUP??
1) Election Vote FRAUD is proven in many States
36 page Navarro Report of Election Fraud in 6 States
https://www.thegatewaypundit.com/2020/12/theft-thousand-cuts-assistant-president-trump-peter-navarro-produces-report-fraud-2020-election/
https://phibetaiota.net/wp-content/uploads/2020/12/Navarro-Report-Six-Dimensions-Election-Irregularities.pdf
 

6) Lawsuits continue in many States and Supreme Court
7) Some State Legislatures may overturn Fraudulent Election in their State (like PA now)

I can’t be the only one with problems with the added pork!


https://www.zerohedge.com/political/pork-city-here-are-most-ridiculous-pet-projects-900-billion-spending-package

Pork City: Here Are The Most Ridiculous Pet Projects In $900 Billion Stimulus Package

Tyler Durden's Photo
by Tyler Durden
Monday, Dec 21, 2020 – 17:40

As Congress prepares to pass a $900 billion COVID-19 stimulus bill rolled into a consolidated appropriations package – with funding for assistance for households and businesses, along with vaccine distribution and other pandemic-related measures, the bill also includes a ton of pork per usual.

Illustration via WSJ.com

https://www.zerohedge.com/political/pork-city-here-are-most-ridiculous-pet-projects-900-billion-spending-package
Pet Pork Projects in the $900 Billion Stimulus Package:
(What do these Pork Projects have to do with Covid Help???)
($50 Billion? in Ridiculous Pet Projects added to Covid Help Bill )
$453 Million to Ukraine
$10 Million for Gender Programs in Pakistan
$3.3 Billion to Israel
$1.3 Billion to Egypt
$700 Million to Sudan
$130 Million to Nepal
$135 Million to Burma
$85.5 Million to Cambodia
$1.4 Billion for Asia Reassurance
$4 Billion for Navy Weapons
$2 Billion for Space Force
$2 Billion for Air Force Missiles
$208 Million to upgrade Census Bureau computers to prep for 2030
$40 Million for the Kennedy Center
$193 Million for HIV/AIDS workers to buy cars and a museum

IF WE HAD 10 OF YOU WE’D RULE THE WORLD: BIDEN TO STACEY ABRAMS (VIDEO) — ARLIN REPORT……………….walking this path together

Originally posted on Burst Updates: Biden spoke at Georgia’s senate runoff campaign yesterday: “Stacey if we had 10 of you we could rule the whole world. God love ya. If you want to do the bidding of Texas, you should be running in Texas.” The dem goal is to beat GOP candidates Loeffler and Perdue…

IF WE HAD 10 OF YOU WE’D RULE THE WORLD: BIDEN TO STACEY ABRAMS (VIDEO) — ARLIN REPORT……………….walking this path together

Driving in the State of Florida

New Zealand Has Quatantine Camps. We Should Be Very Careful!

12/04/20

Mary + Polly Discuss AstraZeneca Vaccine Trial Volunteer, New Zealand ‘Quarantine Camps’ and More

In “This Week” with Mary Holland, Children’s Health Defense vice chair and general counsel, and Polly Tommey, co-producer of “Vaxxed,” Mary and Polly discuss the AstraZeneca vaccine trial participant who says he was injured, New Zealand “quarantine camps” … and more.

Mary + Polly Discuss AstraZeneca Vaccine Trial Volunteer, New Zealand ‘Quarantine Camps’ and More

Conversation-at-a-Glance

  • A participant in India’s AstraZeneca COVID vaccine trials reported to the Serum Institute, which is sponsoring the trial, that he developed acute neuro encephalopathy (a condition similar to what autistic children experience) after receiving the vaccine. “We should be very concerned about the tremendous levels of adverse events in all the COVID vaccine trials, and the obfuscation around who was in the trials.”
  • New Zealand is creating “quarantine camps” where people who test positive for COVID are held against their will until they test negative. “It’s extraordinary that a common law country like New Zealand is leading the charge in these draconian measures.”
  • In Portugal, the court ruled it illegal to force four German tourists into quarantine on the basis of a PCR test — which can give up to 97% false positives. Finland says it will not test healthy people, because there’s too much risk of false positives.
  • Brazil’s president, Jair Bolsonaro, said he will refuse the COVID vaccine. “Good for him, it’s an individual’s right anywhere to refuse unwanted medical intervention, and it’s the law here in the U.S.”
  • Employers can legally mandate the flu vaccine as a measure to prevent employees from getting COVID, but look for this issue to get more contentious. Some employers will also try to mandate COVID vaccines, “but I think legal cases against COVID vaccine mandates will succeed.”
  • Celebrities are being recruited to counter “anti-vaxxers” and guilt people into getting the vaccine “for the common good, for your mother, for your grandmother.” But we’ll have celebrities on our side, too, and they’ll talk about the potential for injuries without liability, and how for vaccine makers and others, “there are trillions of dollars at stake.”
  • In the UK, the British army says it will deploy its information warfare unit against “anti-vax propaganda.” But typically when a country starts deploying the military against its own citizens, “it doesn’t work for very long.”
  • Some good news last week: The Supreme Court said New York can’t restrict the number of people allowed to gather in churches and synagogues. The court ruled that the government can’t use a crisis to overrule the First Amendment.
  • There’s still time to contact the District of Columbia’s mayor and ask her to veto a bill, passed by Nov. 17 by the district’s city council that would allow children 11 and older to get a vaccine without parental consent. If this bill passes, Big Pharma will try to push it through all over the country. Even if you don’t live in D.C. please contact Mayor Bower. Go here for details.

Bill Gates Really Did Say It!

Yes, Bill Gates Said That. Here’s the Proof.

Gates and his minions insist the billionaire never said we’d need digital vaccine passports. But in a June 2020 TED Talk, Gates said exactly that. Someone edited out the statement, but CHD tracked down the original.

Yes, Bill Gates Said That. Here’s the Proof.

Some chiseler altered Bill Gates’ June 2020 TED Talk to edit out his revealing prediction that we will all soon need digital vaccine passports (slide 1). But after considerable effort, we tracked down the original video (slide 2).

Gates’ minions on cable and network news, his public broadcasting, social media and fact-checker toadies all now insist that Gates never said such things. They say he never intended to track and trace us with subdermal chips or injected tattoos.

They dismiss such talk as “conspiracy theories.”

Well, here it is from the horse’s mouth.

In 2019, according to a not-yet-purged Scientific American article, Gates commissioned the Massachusetts Institute of Technology to build an injectable quantum dot dye system to tattoo stored medical info beneath children’s skin. The tattoo was designed to be readable by an iPhone app.

Gates’ company, Microsoft, has patented a sinister technology that uses implanted chips with sensors that will monitor body and brain activity. It promises to reward compliant humans with crypto currency payments when they perform assigned activities.

Gates also invested approximately $20 million in MicroCHIPS, a company that makes chip-based devices, including birth-control implant chips with wireless on/off switches for remote-controlled drug-delivery by medical authorities.

In July 2019, months before the COVID pandemic, Gates bought 3.7M shares of Serco, a military contractor with U.S. and UK government contracts to track and trace pandemic infections and vaccine compliance.

To facilitate our transition to his surveillance society, Gates invested $1 billion in EarthNow, which promises to blanket the globe in 5G video surveillance satellites. EarthNow will launch 500 satellites allowing governments and large enterprises to live-stream monitor almost every “corner” of the Earth, providing instantaneous video feedback with one-second delay.

The Bill and Melinda Gates Foundation also acquired 5.3 million shares of Crown Castle, which owns 5G spy antennas including more than 40,000 cell towers and 65,000 small cells.

Please make your own copy of these clips — as Gates’ power to disappear inconvenient facts is expanding every digital day.

%d bloggers like this: