America plunges toward Third World chaos

DROUGHT collapsing the food supply, LAWLESSNESS collapsing blue cities as America plunges toward Third World chaos

Friday, June 11, 2021 by: Mike Adams

https://www.naturalnews.com/2021-06-11-drought-collapse-food-supply-lawlenessness-blue-cities-america-third-world.html

Bypass censorship by sharing this link:

https://www.afinalwarning.com/526930.html

New

https://www.afinalwarning.com/526930.html Copy URL 25KViews

Image: DROUGHT collapsing the food supply, LAWLESSNESS collapsing blue cities as America plunges toward Third World chaos

(Natural News) We are rapidly approaching the end of America and the end of the world as we know it. Every institution of sustainable civilization is being torn to shreds by the anti-human globalists and their obedient Democrat operatives: The money supply, the food supply, science and medicine, the rule of law, parental rights, medical ethics and even national sovereignty. The governments of the world — America, Canada, Australia, China, etc. — have been transformed into crime syndicates that actively seek to destroy their own populations and nations, and the global extermination agenda using covid biological weapons (spike protein / covid vaccines) is well under way.

We are likely just months away from a total collapse of society as we know it, at least in the high population density cities run by disastrous, suicidal Democrats who seem to despise every pillar of human civilization (families, parents, babies, health, rationality, religion, the rule of law, etc.). Most of America’s largest cities will soon be transformed into inescapable death traps with mass violence, disease, starvation and destitution. Those who can will flee to the rural areas in search of food, shelter and sanity.

Oregon’s leftist legislature just passed a bill that will turn every city in the state into “shanty towns” of tent cities, rife with drug use, prostitution, disease and crime. HB 3115 prevents police from arresting or fining people who are living in tents on public property. Naturally, the only reason so many people are homeless in Oregon, Washington, California and other blue states is because of the disastrous, mentally ill policies put forth by liberals who despise police and hate humanity. Parts of Seattle already resemble South American craphole nations, and Portland isn’t far behind. Soon, every city up and down the Left Coast will be a Third World craphole run by Democrats. Anyone who is able to flee will flee by any means necessary.

Democrats are bringing back the KKK, but this time targeting Whites

Liberal cities will soon be “policed” like CHAZ — where lunatic Leftists armed with AK-47s will serve as left-wing “shock troops” to carry out extreme violence against White people based merely on the color of their skin. This is the revival of the KKK — a concoction of Democrats — now weaponized against Whites instead of Blacks. The police are powerless and have already been defunded in many areas. Those who can leave or retire from law enforcement are doing so in droves. Soon, there will be no functioning law enforcement in any major blue city in America. It’s not difficult to realize what happens after that.

Meanwhile, the covid vaccine bioweapons are being aggressively pushed as mass extermination bioweapons to try to kill every human being possible, meaning sharp population reductions are right around the corner. As the mass deaths emerge, cities will lose large portions of their workers and taxpayers, plunging those cities into economic chaos and accelerating collapse. City services will be cut to nearly nothing, and the infrastructure collapse will be impossible to ignore as bridges, roads, sewage systems and emergency services all cease to function. Even firefighters are getting out of Dodge, as insane, deranged Leftists are now violently attacking firefighters who try to extinguish all the buildings being set on fire by the lunatic Marxist rioters.

Before long, America’s cities will burn. And so will America’s fake fiat currency, the dollar. That’s when the communist Chinese invasion is fast-tracked to invade and occupy America, while Chinese troops shoot to kill every living man, woman and child they see. Thus, the deliberate internal collapse of America is only the preparation for the invasion and occupation that’s planned as the next stage.

Meanwhile, Biden and the Democrats are rearranging the deck chairs on the Titanic.

And the average American consumer is oblivious to the reality of what’s happening in the world.

Some of us will survive this, but only those who are really well informed and have taken steps to prepare in advance. In addition to warning people about what’s coming, I do my best to help people get prepared. Watch all my how-to survival videos at PrepWithMike.com (with more new videos coming soon).

Get the full analysis here, via Brighteon.com:

Brighteon.com/ecaf0e82-f437-4e7d-92b2-00776069a082

https://www.brighteon.com/embed/ecaf0e82-f437-4e7d-92b2-00776069a082

See a new podcast each day at:

https://www.brighteon.com/channels/hrreport

The banner was similar to the one unfurled at Yankee Stadium just days prior. They both read “Trump Won – Save America”

Share TweetGab ShareTelegram Share Email

IT’S SPREADING: “Trump Won” Banner Unfurled at Boston Red Sox Game – Fan Escorted From Fenway Park by Security (VIDEO)

By Cristina Laila
Published June 7, 2021 at 9:06pm
492 Comments Share (1.2k) Tweet Share to GabTelegram Share

It’s spreading!

A fan at Fenway Park on Monday evening unfurled a “Trump Won” banner during a Boston Red Sox game.

Advertisement – story continues below

The crowd went wild and cheered as the Trump supporters displayed his banner.

VIDEO:

TRENDING: BOOM! Gen. Mike Flynn Drops Powerful Video – Trump Warns “Dishonest and Corrupt” Evildoers What’s Coming, “It’s Our Turn, And the Gloves Are Off” https://platform.twitter.com/embed/Tweet.html?creatorScreenName=cristinalaila1&dnt=true&embedId=twitter-widget-0&features=eyJ0ZndfZXhwZXJpbWVudHNfY29va2llX2V4cGlyYXRpb24iOnsiYnVja2V0IjoxMjA5NjAwLCJ2ZXJzaW9uIjpudWxsfSwidGZ3X2hvcml6b25fdHdlZXRfZW1iZWRfOTU1NSI6eyJidWNrZXQiOiJodGUiLCJ2ZXJzaW9uIjpudWxsfSwidGZ3X3R3ZWV0X2VtYmVkX2NsaWNrYWJpbGl0eV8xMjEwMiI6eyJidWNrZXQiOiJjb250cm9sIiwidmVyc2lvbiI6bnVsbH19&frame=false&hideCard=false&hideThread=false&id=1402041386946465793&lang=en&origin=https%3A%2F%2Fwww.thegatewaypundit.com%2F2021%2F06%2Fspreading-trump-won-banner-unfurled-boston-red-sox-game-fan-escorted-fenway-park-security-video%2F&sessionId=5c2df268a4cf0ecfc3331008a1f322261570c608&theme=light&widgetsVersion=82e1070%3A1619632193066&width=550px

Advertisement – story continues below

According to a Boston Red Sox spox, the fan was escorted from Fenway Park by security for violating the park’s policy prohibiting signs.

Last week at a New York Mets game, a “Trump Won” banner was displayed during the baseball game.

The banner was similar to the one unfurled at Yankee Stadium just days prior. They both read “Trump Won – Save America”

Malamute Puppy – Quetzalli – (kayts-ahl-lee) (precious thing) Kasa (dressed in furs) — Manifest Injustice

Originally posted on J & J Ranch, Stone Mtn, GA: Ok, so I went and picked up a special baby. She is AKC Giant Malamute. She is four (4) months old. Her name, when we picked her up was Precious. We know I could not leave it at that, so I named her Native American…

Malamute Puppy – Quetzalli – (kayts-ahl-lee) (precious thing) Kasa (dressed in furs) — Manifest Injustice

Ebola Research Fort Detrick Maryland – Infect Monkeys With Ebola

ebola news ebola virus

You will have to wonder not only who owns the patent on the ebloa virus, plus you will have to wonder why they are infecting animals with the virus, in the United States.

Dr. Fauci did warn something worse is coming. If you remember correctly, Dr. Fauci stated outright, while Trump was president, that there would be a pandemic during his presidency.

Never take Dr. Fauci’s words as meaningless. Look what happened with COVID-19, and he has predicted something far worse will hit the civilian population. Is this of what he spoke? EBOLA

Apply NowJob DetailsEstimated: $33,000 – $49,000 a yearBenefits

  • Health insurance
  • Vision insurance
  • Dental insurance
  • 401(k)

Full Job Description

Piper Life Sciences is currently seeking a NHP (non-human primate) Animal Technician in Gaithersburg, MD to support a major area pre-clinical contract research organization in the development and testing of infectious disease vaccine candidates.

Responsibilities of the NHP (non-human primate) Animal Technician

  • Lead efforts in viral inoculation, blood draws, IV infusion and other research-based techniques on non-human primates (NHP)
  • Utilize laboratory facility to provide support to animal subjects and provide humane treatment of research animals
  • Assist with other laboratory techniques such as animal necropsy or euthanasia, intubation and animal surgeries

Qualifications of the NHP (non-human primate) Animal Technician

  • 1+ year experience working with mice, rats, pigs, guinea pigs, macaques, or non-human primates NHP (non-human primate experience preferred but not required)
  • Experience in lieu of degree will work

Compensation for the NHP (non-human primate) Animal Technician

Wal-Mart.com USA, LLC
  • Salary: Commensurate with experience
  • Medical, Dental, Vision, 401k

Outbreak Response ScientistAlaka`ina Foundation Family of Companies – 3.4Fort Detrick, MD

Apply NowJob DetailsEstimated: $67,000 – $88,000 a yearBenefits

  • Life insurance
  • Disability insurance
  • Health insurance
  • Dental insurance
  • 401(k)

Qualifications

  • Microsoft Excel
  • Laboratory experience
  • Clinical laboratory experience
  • Communication skills
  • Microsoft Word
  • Bachelor’s degree
  • Bachelor of Science

Full Job Description

Laulima Government Solutions, LLC is looking for a qualified Outbreak Response Scientist to provide leadership support services for the National Institute of Allergies and Infectious Disease (NIAID) in a high containment facility in Fort Detrick, MD.

Description of Responsibilities:Support activities for laboratory preparedness and response to outbreaks of high consequence viral pathogens in field settings.
Support research with refined animal models for biodefense agents and facilitate testing of human samples associated with naturally occurring outbreaks in the high containment environment.
Potentially participate in deployment rotations to international and domestic sites.
Assist with Ebola virus disease survivor surveillance and research activities in Africa.
Comply with the NIH Division of Occupational Health and Safety requirement for satisfactory completion of the Biosurety program and Select Agent program.
Play a role in ensuring that the Biosurety program promotes a security conscious culture.
Comply with the physical security, protection of the division’s property, protection of information, cyber security, agent protection, control and accountability, safe disposal and waste handling, and personal security guidelines set forth by the division’s Biosurety program.Degree/Education/Certification Requirements:
Minimum of a full 4-year course of study from an accredited college or university leading to a Bachelor of Science or higher degree.
Ability to work in BSL-4 setting

Required Skills and Experience:
3-5 years’ related experience
Must have prior laboratory experience, including running various assays (immunologic, virologic, molecular)
Experience in biochemistry or hematology.
Ability to obtain/maintain DoJ Security Risk Assessment (SRA) approval.
Must be willing to be immunized with licensed and FDA approved Investigational New Drugs (IND) recommended for persons at risk to occupational exposure of biological agents
Must be willing to participate in periodic drug screening.
Must have the ability to obtain/maintain certification in Chemical Personnel Reliability Program and/or Biological Personnel Reliability Program.
Must have the ability to obtain/maintain CDC Select Agent Program approval.
Prior experience working in BSL-2 facilities, willingness to work BSL-3, and BSL-4 conditions. Able to wear respiratory protection.
Must be willing to travel once called upon for a month at a time on average.

Desired Skills and Experience:
Experience working effectively and respectfully with diverse groups in international settings.
Familiarity with the conduct of clinical laboratory diagnostics, including molecular, immunologic, and virologic testing.
Experience with viral Select Agents is highly desired.
Good Clinical Laboratory Practice (GCLP) experience is preferred.
Proficiency in Word, Excel, and PowerPoint.
Basic understanding of laboratory information management systems (LIMS).
Demonstrate interpersonal, oral and written communication, and organizational skills.
Demonstrate ability to work independently, design experiments, and analyze data.
French language skills.

Clearance:
Must be a US citizen or permanent resident.
Must be able to meet the requirements for Tier 3 level investigation.

Laulima Government Solutions, LLC is a fast-growing government service provider. Employees enjoy competitive salaries; a 401K plan with company match; medical, dental, disability, and life insurance coverage; tuition reimbursement; paid time off; and 10 paid holidays. Laulima Government Solutions, LLC is proud to be an equal opportunity employer.

We are an Equal Opportunity/Affirmative Action Employer of individuals with disabilities and veterans. We are proud to state that we do not discriminate in employment decisions on the basis of race, color, religion, sex, pregnancy, sexual orientation, gender identity, national origin, age, protected veteran status, or disability status. If you are a person with a disability and you need an accommodation during the application process, please click here to request accommodation. We E-Verify all employees.

The Alaka`ina Foundation Family of Companies (FOCs) is comprised of industry-recognized government service firms designated as Native Hawaiian Organization (NHO)-owned and 8(a) certified businesses. The Family of Companies (FOCs) includes Ke`aki Technologies, Laulima Government Solutions, Kūpono Government Services, and Kapili Services, Po`okela Solutions, Kīkaha Solutions, LLC, and Pololei Solutions, LLC. Alaka`ina Foundation activities under the 501(c)3 principally benefit the youth of Hawaii through charitable efforts which includes providing innovative educational programs that combine leadership, science & technology, and environmental stewardship.

For additional information, please visit http://www.alakainafoundation.com

#monster


EBOLA RESEARCH NOW HIRINGINFECT MONKEYS WITH EBOLA IN MARYLANDhttps://leidosbiomed.csod.com/ats/careersite/JobDetails.aspx?site=4&id=1616

Ebola

Clinical Budget Analyst III – Ebola Research

Job ID: req1616
Employee Type: exempt full-time
Facility: Frederick: INDUS
Location: 5705 Industry Lane, Frederick, MD 21704 USA

The Frederick National Laboratory is a Federally Funded Research and Development Center (FFRDC) sponsored by the National Cancer Institute (NCI) and operated by Leidos Biomedical Research, Inc.  The lab addresses some of the most urgent and intractable problems in the biomedical sciences in cancer and AIDS, drug development and first-in-human clinical trials, applications of nanotechnology in medicine, and rapid response to emerging threats of infectious diseases.

Our core values of accountability, compassion, collaboration, dedication, integrity, and versatility serve as a guidepost for how we do our work every day in serving the public’s interest.

Position Overview:

PROGRAM DESCRIPTION

Within Leidos Biomedical Research Inc., the Clinical Monitoring Research Program Directorate (CMRPD) provides high-quality comprehensive and strategic operational support to the high-profile domestic and international clinical research initiatives of the National Cancer Institute (NCI), National Institute of Allergy and Infectious Diseases (NIAID), Clinical Center (CC), National Heart, Lung and Blood Institute (NHLBI), National Institute of Arthritis and Musculoskeletal and Skin Diseases (NIAMS), National Center for Advancing Translational Sciences (NCATS), National Institute of Neurological Disorders and Stroke (NINDS), and the National Institute of Mental Health (NIMH). Since its inception in 2001, CMRPD’s ability to provide rapid responses, high-quality solutions, and to recruit and retain experts with a variety of backgrounds to meet the growing research portfolios of NCI, NIAID, CC, NHLBI, NIAMS, NCATS, NINDS, and NIMH has led to the considerable expansion of the program and its repertoire of support services. CMRPD’s support services are strategically aligned with the program’s mission to provide comprehensive, dedicated support to assist National Institutes of Health (NIH) researchers in providing the highest quality of clinical research in compliance with applicable regulations and guidelines, maintaining data integrity, and protecting human subjects. For the scientific advancement of clinical research, CMRPD services include comprehensive clinical trials monitoring, regulatory, pharmacovigilance, protocol navigation and development, and programmatic and project management support for facilitating the conduct of 400+ Phase I, II, and III domestic and international trials on a yearly basis. These trials investigate the prevention, diagnosis, treatment of, and therapies for cancer, influenza, HIV, and other infectious diseases and viruses such as hepatitis C, tuberculosis, malaria, and Ebola virus; heart, lung, and blood diseases and conditions; parasitic infections; rheumatic and inflammatory diseases; and rare and neglected diseases. CMRPD’s collaborative approach to clinical research and the expertise and dedication of staff to the continuation and success of the program’s mission has contributed to improving the overall standards of public health on a global scale.

The Clinical Monitoring Research Program Directorate (CMRPD) provides support to the financial management and oversight of NIAID DCR’s clinical research studies, including Ebola, HIV, COVID and other clinical research studies. The position will compile and assist with the analysis of financial information for clinical research efforts supported within the program.

KEY ROLES/RESPONSIBILITIES

  • This position is in direct support of the Ebola clinical research projects in Africa, to include all financial aspects and detailed subcontractor management
  • Gathers, analyzes, prepares and summarizes recommendations for financial plans, acquisition activity, trending future requirements, operating forecasts, etc.
  • Monitors and provides monthly expense analyses on complex projects/problems in which analysis of situations or data requires an evaluation of tangible and intangible variables
  • Works with the Business Analyst IV, primary program managers and clinical research teams to develop internal budgets that include all projected costs applicable to the clinical research studies and projects
  • Develops detailed final budgets, in conjunction with the supervisor and project teams, identifying all clinical research activities, tests, and other associated activities to be performed during the conduct of the study based on the study protocol and related documents
  • Works closely with partner organizations, including subcontractors, to ensure final project/study budgets are adhered to and updated when necessary, following appropriate steps for review and approval
  • Assists with performing financial forecasting and reconciliation of internal accounts
  • Prepares, monitors and analyzes cost proposals, reports and staffing for review by the supervisor and/or project team
  • Oversees subcontractor budgets and cost proposals in support of CMRPD’s Ebola research in Africa.
  • Prepares closing financial reports and obtains proper approvals from program management
  • Maintains annual budget assumption documents with up-to-date information to track for actuals, approvals and estimates at completion details
  • Maintains and tracks protocol budget documentation and conducts regular audits to ensure the accuracy and completeness of these records
  • Assignments may be performed independently with the support of program management staff or in conjunction with other Business Analysts within CMRPD
  • Works with supervisor on complex clinical research studies where analysis requires an in-depth evaluation of variable factors
  • This position is located in Frederick, Maryland

BASIC QUALIFICATIONS

  • Possession of Bachelor’s degree from an accredited college/university according to the Council for Higher Education Accreditation (CHEA) or four (4) years relevant experience in lieu of degree.  Foreign degrees must be evaluated for U.S. equivalency.
  • In addition to the education requirements, a minimum of five (5) years progressively responsible job-related experience
  • Progressively responsible experience must demonstrate increased independence and overall responsibility for more complex projects
  • Demonstrated experience with analysis of budgets and costs, including burn rates and cost projections
  • Demonstrated ability of budget building and cost tracking
  • Ability to collect and disseminate information in a clear, concise manner
  • Ability to create Excel and database reports
  • Ability to track multiple projects concurrently
  • Advanced knowledge of MS Office Suite including Excel (advanced), PowerPoint (advanced), and Word (intermediate)
  • Excellent research and investigative skills with a high degree of accuracy and attention to detail
  • Ability to review complex documents independently and/or in collaboration with clinical research managers, and determine sufficiency of financial documentation
  • Ability to obtain and maintain a security clearance

PREFERRED QUALIFICATIONS

Candidates with these desired skills will be given preferential consideration:

  • Experience working with the U.S. Government or as a Government Contractor
  • Knowledge of governmental regulations; working knowledge of the FAR/FTR
  • Budgetary and strategic planning experience and responsibilities as it relates to clinical research
  • Knowledge of study design, clinical and biospecimen terms used in research studies and scientific and medical concepts and terminology
  • Master’s Degee in Business Administration or related field
  • Experience with ERP systems, especially IBM Cognos, Costpoint and Focuspoint

Equal Opportunity Employer (EOE) | Minority/Female/Disabled/Veteran (M/F/D/V) | Drug Free Workplace (DFW)

SICK: Demented Woman

SICK: Demented Woman Thrusts Dildo at Pastor’s 13-Year-Old Daughter Outside Drag Queen Brunch Marketed to Kids, Police Laugh (VIDEO)

By Cassandra Fairbanks
Published May 27, 2021 at 10:55am

https://www.thegatewaypundit.com/2021/05/sick-demented-woman-thrusts-dildo-pastors-13-year-old-daughter-outside-drag-queen-brunch-marketed-kids-police-laugh-video/

A 13-year-old girl was sexually harassed by am unhinged woman attending a drag queen story hour event in Ohio, and the police appeared to think the situation was funny.

The woman was taunting the Christian protesters outside the Drag Me to Brunch held at the Sorg Opera House in Ohio.

The event was advertised as “free” to children under five, and $10 for children aged 6-17.

According to a shocking report from Kim Coulter at the National File, an attendee of the event appeared to use drugs and was waving an oversized realistic male genitalia shaped sex toy sticking out of her pants at a 13-year-old girl.

“The woman with the sex toy then appeared to make sexual gestures toward the child with the toy hanging from her pants. The woman’s identity is unknown at this time, but she was reported to the police who took her information pending an investigation.”

The girl was the daughter of Pastor John Williams, who frequently protests these events that target children.

“When asked to leave the child alone, the LGBT ally appeared to make sexual gestures towards the child and insists she is legally permitted to speak with the child with the oversized sex toy hanging out of her pants. Williams then attempted to notify police on the scene who were “shooting the breeze”down the block instead of watching the protestors who were clearly being antagonized by attendants of there Drag Me to Brunch event. One officer seemed to mock Williams, while another quietly laughed,” Coulter reports.

“If this is how the attendants behaved outside the event, what kind of depravity is going on inside, and why are children under 5 permitted free access to such an event,” asked Williams in his discussion with National File.

When Williams reported the disgusting harassment of his child to the police, they laughed. https://www.youtube.com/embed/zebVlDq6L6E?start=74&feature=oembed

Tiponi — Manifest Injustice — J & J Ranch, Stone Mtn, GA

Last night my baby-girl (4-legged), died for no apparent reason. I have to assume she was poisoned. An hour earlier, she was happy and healthy. She laid down and died, and it is breaking my heart! She was eight years old, the date on my camera is wrong. She was born in 01-2013. Tiponi — Manifest […]

Tiponi — Manifest Injustice — J & J Ranch, Stone Mtn, GA

FACTS ON COVID VACCINE INGREDIENTS, MUST READ!!!

Has anyone else had a chance to read the MSDS for the COVID-19 vaccines?

Go to: https://portal.ct.gov/-/media/Coronavirus/Community_Resources/Vaccinations/Print-Materials/Fact-Sheets/Ingredients_English.pdf

There, you can download the ingredients, and see the literature that most people see. Not knowing what the ingredients are, you might not think too much about it.

Notice the ingredients list “SM-102”. Go here for the actual MSDS Sheet: https://www.caymanchem.com/msdss/33474m.pdf

__________________________________________________________________________________________________

Safety Data Sheet
acc. to OSHA HCS
Printing date 04/11/2021 Revision date 04/11/2021

Product identifier
· Trade name: SM-102
· Synonym 8-[(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl]amino]-octanoic acid, 1-octylnonyl ester
· Article number: 33474
· Application of the substance / the mixture For research use only, not for human or veterinary use.
· Details of the supplier of the safety data sheet
· Manufacturer/Supplier:
Cayman Chemical Co.
1180 E. Ellsworth Rd.
Ann Arbor, MI 48108
USA
· Information department: Product safety department
· Emergency telephone number:
During normal opening times: +1 (734) 971-3335
US/CANADA: 800-424-9300
Outside US/CANADA: 703-741-5970

______________________________

2 Hazard(s) identification
· Classification of the substance or mixture

d~GHS02 Flame
Flam. Liq. 2 H225 Highly flammable liquid and vapor.
d~GHS06 Skull and crossbones
Acute Tox. 2 H310 Fatal in contact with skin.
d~GHS08 Health hazard
Carc. 2 H351 Suspected of causing cancer.
Repr. 2 H361 Suspected of damaging fertility or the unborn child.
STOT RE 1 H372 Causes damage to the central nervous system, the kidneys, the liver and the
respiratory system through prolonged or repeated exposure.
d~GHS09 Environment
Aquatic Chronic 1 H410 Very toxic to aquatic life with long lasting effects.
d~GHS07

Acute Tox. 4 H302 Harmful if swallowed.
Skin Irrit. 2 H315 Causes skin irritation.
Eye Irrit. 2A H319 Causes serious eye irritation.
Aquatic Acute 3 H402 Harmful to aquatic life.
· Label elements
· GHS label elements
The product is classified and labeled according to the Globally Harmonized System (GHS).
· Hazard pictograms
d~GHS02; d~ GHS06; d~ GHS07; d~ GHS08; d~ GHS09;
· Signal word Danger
· Hazard-determining components of labeling: Chloroform
· Hazard statements: H225 Highly flammable liquid and vapor. H302 Harmful if swallowed.
H310 Fatal in contact with skin. H315 Causes skin irritation. H319 Causes serious eye irritation.
H351 Suspected of causing cancer. H361 Suspected of damaging fertility or the unborn child.
H372 Causes damage to the central nervous system, the kidneys, the liver and the respiratory system through prolonged or repeated exposure.
H402 Harmful to aquatic life.
H410 Very toxic to aquatic life with long lasting effects.
· Precautionary statements
Obtain special instructions before use.
Do not handle until all safety precautions have been read and understood.
Keep away from heat/sparks/open flames/hot surfaces. – No smoking.
Keep container tightly closed.
Ground/bond container and receiving equipment.
Use explosion-proof electrical/ventilating/lighting/equipment.
Use only non-sparking tools.

Take precautionary measures against static discharge.
Do not breathe dust/fume/gas/mist/vapors/spray.
Do not get in eyes, on skin, or on clothing.
Wash thoroughly after handling.
Do not eat, drink or smoke when using this product.
Avoid release to the environment.
Wear protective gloves/protective clothing/eye protection/face protection.
If swallowed: Call a poison center/doctor if you feel unwell.
If on skin (or hair): Take off immediately all contaminated clothing. Rinse skin with water/shower.
If in eyes: Rinse cautiously with water for several minutes. Remove contact lenses, if present and easy to do. Continue rinsing.

Immediately call a poison center/doctor.
IF exposed or concerned: Get medical advice/attention.
Specific treatment (see on this label).
Get medical advice/attention if you feel unwell.


There are 11 pages of this mess. You will have to read it to believe it. And they are shooting people up with this shit, and it specifically states not for human or animal use…??!!!!!!

Biden’s Commission Will Decide if Congress Can Start Reversing Supreme Court Rulings and Pack the Court — Truth2Freedom’s Blog

America has had nine justices on the Supreme Court since 1869, but now that conservatives hold a 6 to 3 majority some Democratic lawmakers and liberal groups say it’s out of balance and needs to be fixed. Source: Biden’s Commission Will Decide if Congress Can Start Reversing Supreme Court Rulings and Pack the Court

Biden’s Commission Will Decide if Congress Can Start Reversing Supreme Court Rulings and Pack the Court — Truth2Freedom’s Blog

The Corrupted January 6 Commission


print-icon

Authored by Technofog via The Reactionary,

By Tyler DurdenMonday, May 17, 2021 – 10:30 PM

Late last week, House Democrats unveiled their Bill to “establish the National Commission to Investigate the January 6 Attack on the United States Capitol Complex.”

We previously warned about the Democrats’ roadmap to use their investigative authority to further their political goals. We advised that Democrats make the investigation broad enough to subpoena records from conservative groups and websites – and their investors. We warned that they would seek donor lists and personal communications from those having little to do with the events on January 6.

The Democrats’ Bill – which elevates the January 6 “riot” to a “domestic terrorist attack on the Capitol” – proves us right.

The Bill establishes a Commission of 10 members, five appointed by Democrats and five appointed by Republicans. It will be chaired by a Democrat nominee.

The Commission will have powers to:

“Issue subpoenas requiring the attendance and testimony of witnesses and the production of evidence relating to any matter which the Commission is empowered to investigate.”

From that language we look to what the Commission is “empowered to investigate.” This power is extremely broad. And this is where the trouble lies. It includes:

“The facts and causes relating to the January 6, 2021 domestic terrorist attack upon the United States Capitol Complex.”

“The influencing factors that fomented such attack on American representative democracy while engaging in a constitutional process.”

The Danger

The dangerous part about all this is that the subpoena power is limited to the imagination of the Democrat appointees. (We assume the likelihood that at least one Republican member of the Committee will go along with anything the Democrats want, thus giving them majority vote for a subpoena.)

We also note that the Commission is given the power to obtain information from “the intelligence community” to further its investigation.

We cannot stress strongly enough the danger of such powers. The House Democrats – those who have leaked false intelligence to the press and lied to the public about the Carter Page FISA applications – will have access, via their appointees, to raw intelligence data. Their history shows they will not use this information responsibly.

All this just proves that the Commission will be their instrument to inflict massive political harm on the Right. Remember Pelosi’s occupation of the Capitol?

As I said on March 5, 2021:

“If you question the seriousness of the game they’re playing, just look at the security around the Capitol. Currently, over 5,000 National Guard troops, along with fencing and razor wire, protect against a non-existent threat. The occupation is theater to make January 6 more than what it was to justify what is to come.

New Report Sheds Light on Vaccine Doomsday Cult

y Mike Whitney Global Research, May 04, 2021 Theme: Science and Medicine

https://www.globalresearch.ca/new-report-sheds-light-vaccine-doomsday-cult/5744267

Featured image is from The Unz Review

This article was originally published on The Unz Review.

All Global Research articles can be read in 51 languages by activating the “Translate Website” drop down menu on the top banner of our home page (Desktop version).

***

“The risk-benefit calculus is therefore clear: the experimental vaccines are needless, ineffective and dangerous. Actors authorizing, coercing or administering experimental COVID-19 vaccination are exposing populations and patients to serious, unnecessary, and unjustified medical risks.” Doctors for Covid Ethics, April 29, 2021

An explosive new study by researchers at the prestigious Salk Institute casts doubt on the current crop of gene-based vaccines that may pose a grave risk to public health. The article, which is titled “The novel coronavirus’ spike protein plays additional key role in illness”, shows that SARS-CoV-2’s “distinctive ‘spike’ protein”..”damages cells, confirming COVID-19 as a primarily vascular disease.” While the paper focuses strictly on Covid-related issues, it unavoidably raises questions about the new vaccines that contain billions of spike proteins that could greatly increase the chances of severe illness or death. Here’s an excerpt from the article dated April 30, 2021:

“In the new study, the researchers created a “pseudovirus” that was surrounded by SARS-CoV-2 classic crown of spike proteins, but did not contain any actual virus. Exposure to this pseudovirus resulted in damage to the lungs and arteries of an animal model—proving that the spike protein alone was enough to cause disease. Tissue samples showed inflammation in endothelial cells lining the pulmonary artery walls. (Note– “Vascular endothelial cells line the entire circulatory system, from the heart to the smallest capillaries.”)

The team then replicated this process in the lab, exposing healthy endothelial cells (which line arteries) to the spike protein. They showed that the spike protein damaged the cells by binding ACE2. This binding disrupted ACE2’s molecular signaling to mitochondria (organelles that generate energy for cells), causing the mitochondria to become damaged and fragmented.

Previous studies have shown a similar effect when cells were exposed to the SARS-CoV-2 virus, but this is the first study to show that the damage occurs when cells are exposed to the spike protein on its own.” (“The novel coronavirus’ spike protein plays additional key role in illness”, Salk.edu)

The new research paper is the equivalent of a hydrogen bomb. It changes everything by confirming what vaccine critics have been theorizing for months but were unable to prove.

Now there is solid evidence that:

  1. Covid-19 is primarily a disease of the vascular system (The vascular system, also called the circulatory system, is made up of the vessels that carry blood and lymph through the body.) and not the respiratory system.
  2. The main culprit is the spike protein. (Spike protein–“a glycoprotein that protrudes from the envelope of some viruses” Merriam-Webster “Like a key in a lock, these spike proteins fuse to receptors on the surface of cells, allowing the virus’s genetic code to invade the host cell, take over its machinery and replicate.” Bruce Lieberman)

Simply put, if Covid-19 is primarily a vascular disease and if the main instrument of physical damage is the spike protein, then why are we injecting people with billions of spike proteins?

Here’s how architect and author, Robin Monotti Graziadei, summed up these developments on you tube:

“So, we have been told for the last year, that the only role the spike protein was supposed to play was to enter the human cells. (But) It’s clear, that that is not what they do, (since) they give you illness, vascular illness. Vascular illness can have many manifestations. They can include sinus vein thrombosis, blood clots, bruising, and longer-term conditions. Do you think it’s a good idea to bypass the first (defenses) of your immune system, …and inject… trillions of spike proteins in your cells given the information that has just been released by the Salk Institute? Think about it….

Salk Institute researchers have told us –without any ambiguity– that the spike protein is a fundamental part of the Covid-19 disease. Yes, it’s true that the spike protein with the N-protein, will not replicate. However, trillions (of these proteins) induced by the vaccine injection have the capacity to create damage in your vascular system. This is what the study says and what has been published by an extremely important center for biological studies. This is not a conspiracy theory. I think, at this stage, there is enough information to consider whether we will be told the truth in the coming days, because such information should be on the cover of every newspaper and the top story on every news channel. And what they should say is this: “The fundamental and technological basis –on which all of the vaccines that were distributed in the West– is flawed. We thought that the spike protein would only enter the cells to create antibodies so if you faced the wild virus, it would not latch onto your cells, however, we were wrong. We were wrong because the spike protein in itself, creates disease, and if you inject trillions of them into a human body, there will be manifestations of disease in many cases.” It is not safe to inject trillions of spike proteins into a muscle, because it bypasses layers of your immune system which could have potentially neutralized the virus… By crossing the threshold of the human body through the injection of these compounds, you are not giving your immune system the chance to mount a strong enough response to the spike protein in order to neutralize it. (The vaccine) will have this disease-creating spike protein in it if you agree (to take) any of these vaccines. ….It is now up to us to try to fix the mistake they have made.” (Robin Monotti Graziadei on the new Salk Institute research paper, You Tube, –See it before it is removed)The Novel Coronavirus’ Spike Protein Plays Additional Key Role in Illness

Perfectly stated and right on the money. Graziadei extrapolates the hidden meaning of the Salk report and clarifies its significance. How are the public health officials, the politicians, the media and the rest of the pro-Covid Vaxx camp going to respond to these revelations especially with the imprimatur of the Salk Institute affixed to the front of the report? Will they try to sweep it under the rug or will they try to divert the public’s attention to the ‘variant’ hobgoblin? Or will they try something else entirely, like claim that one class of spike proteins are good for you while others lead to protracted illness and death? What will they do?

Doctor Vladimir Zelenko, who has been nominated for a Nobel Peace Prize for his use of hydroxychloroquine in the treatment of COVID-19 patients, had this to say:

“Do you understand what this means——we are are injecting viral genetic code for the spike protein into innocent people andiIt gets into almost every cell In the body.” (Nobel nominee, Zelenko has also been banned from Twitter.)

Indeed, that’s precisely what they’ve done. And, let’s not forget, the vaccine manufacturers have complete legal immunity for the injuries they produce. Legal immunity means moral impunity.

So what effect will these spike proteins have on the people that have gotten vaccinated?

Here’s what the Doctors for Covid Ethics have to say in their latest article that was published just this week:

“The vaccines are dangerous to both healthy individuals and those with pre-existing chronic disease, for reasons such as the following: risk of lethal and non-lethal disruptions of blood clotting including bleeding disorders, thrombosis in the brain, stroke and heart attack; autoimmune and allergic reactions; antibody-dependent enhancement of disease; and vaccine impurities due to rushed manufacturing and unregulated production standards….

...all gene-based vaccines can be expected to cause blood clotting and bleeding disorders…. The vaccines are not safe.”(“COVID Vaccines: Necessity, Efficacy and Safety”, Doctors for Covid Ethics)

There it is in black and white: “The vaccines are not safe”. Here’s more from an article at Children’s Health Defense about Professor Yehuda Shoenfeld, the Israeli clinical immunologist who is widely credited as the “father of autoimmunity.” Shoenfeld approaches the issue from an entirely different angle. Take a look:

“Shoenfeld’s primary concern boils down to what’s called molecular mimicry. There are a number of genetic sequences that are identical both in the human genome and that of SARS-CoV-2 …

The immunologists go on to draw particular attention to the identical sequences in a specific group of proteins found deep in the lungs (the site of ARDS/covid pneumonia)… This is a concern Shoenfeld …

It’s why Shoenfeld and colleagues have been banging on the drum during the vaccine development phase last year, arguing that peptide sequences used in the new vaccines should be unique and not be common to ones found in the body.

For a predisposed individual, an adverse reaction to the vaccine, Shoenfeld and colleagues argue, could be enough for them to be tipped over the edge — into autoimmune disease.One of the most obvious signals for predisposition is to already have one of the over 100 autoimmune diseases that are charging through industrialized societies. Yet, with the father of autoimmunity sounding the warnings of autoimmune risks, there is scarcely a word of caution being uttered by governments rolling out the mass vaccination programs. Shame on them.” (“Are We on the Verge of a ‘Super-Epidemic’ of Autoimmune Diseases?” Children’s Health Defense)

My limited understanding of “molecular mimicry”, is this: By injecting proteins into the body that are so similar to the Covid proteins that are wreaking havoc in the vascular system, we could trigger a situation in which the body’s immune system attacks its own organs or vascular system. Which is why the author asks: Are We on the Verge of a ‘Super-Epidemic’ of Autoimmune Diseases?

In earlier articles, we presented the views of scientists and medical professionals who anticipated the issues that are now emerging in relation to the spike protein. For example, here is an excerpt from a piece about pediatric rheumatologist, Dr. J. Patrick Whelan, who said the following in a letter to the FDA:

“I am concerned about the possibility that the new vaccines aimed at creating immunity against the SARS-CoV-2 spike protein have the potential to cause microvascular injury to the brain, heart, liver and kidneys in a way that does not currently appear to be assessed in safety trials of these potential drugs….

“Before any of these vaccines are approved for widespread use in humans, it is important to assess in vaccinated subjects the effects of vaccination on the heart. As important as it is to quickly arrest the spread of the virus by immunizing the population, it would be vastly worse if hundreds of millions of people were to suffer long-lasting or even permanent damage to their brain or heart microvasculature as a result of failing to appreciate in the short-term an unintended effect of full-length spike protein-based vaccines on these other organs.” (“Scientists Challenge Health Officials on Vaccinating People Who Already Had COVID”, Global Research)

We also pointed out that “gene-based vaccines release a spike protein that spreads throughout the body, gets trapped in the bloodstream and collects in the layer of cells (endothelial cells) that coat the blood vessels.” We think the new research by the Salk Institute supports this general theory.

Also, according to Dr. Hyung Chun, a Yale cardiologist, the cells “release inflammatory cytokines that further exacerbate the body’s inflammatory response and lead to the formation of blood clots. Chun has stated: “The ‘inflamed’ endothelium likely contributes not only to worsening outcome in COVID-19, but also is considered to be an important factor contributing to risk of heart attacks and strokes.”

This seems to suggest that the spike protein from the vaccine can have the same effect as the spike protein from the infection. Here’s more:

“Individuals with COVID-19 experience a vast number of neurological symptoms, such as headaches, ataxia, impaired consciousness, hallucinations, stroke and cerebral hemorrhage. But autopsy studies have yet to find clear evidence of destructive viral invasion into patients’ brains, pushing researchers to consider alternative explanations of how SARS-CoV-2 causes neurological symptoms….

If not viral infection, what else could be causing injury to distant organs associated with COVID-19?

The most likely culprit that has been identified is the COVID-19 spike protein released from the outer shell of the virus into circulation. Research cited below has documented that the viral spike protein is able to initiate a cascade of events that triggers damage to distant organs in COVID-19 patients.

Worryingly, several studies have found that the spike proteins alone have the capacity to cause widespread injury throughout the body, without any evidence of virus.

What makes this finding so disturbing is that the COVID-19 mRNA vaccines manufactured by Moderna and Pfizer and currently being administered throughout the U.S. program our cells to manufacture this same coronavirus spike protein as a way to trigger our bodies to produce antibodies to the virus.”(“Could Spike Protein in Moderna, Pfizer Vaccines Cause Blood Clots, Brain Inflammation and Heart Attacks?” Global Research)

The above quote is key to grasping what Covid really is and why the new vaccines threaten to greatly exacerbate the problem. As Chun says:

“…autopsy studies have yet to find clear evidence of destructive viral invasion into patients’ brains, pushing researchers to consider alternative explanations of how SARS-CoV-2 causes neurological symptoms….”

This observation is correct. The research does not indicate “viral invasion into patients’ brains”.

Why? Because–as the Salk report indicates– it is not the viral infection that is getting into the brain but the spike protein that has passed the blood-brain barrier via the vascular system.

Here’s Dr Chun again: “What else could be causing injury to distant organs associated with COVID-19?”

Once again, it is not the virus but the spike protein and the autoimmune response.

Finally, Chun acknowledges that the new vaccines “program our cells to manufacture this same coronavirus spike protein as a way to trigger our bodies to produce antibodies to the virus.”

The production and distribution of these potentially-lethal injections goes way beyond mere recklessness. This is an unprecedented global catastrophe that could result in the deaths of millions. How long will this insanity continue?

*

Note to readers: please click the share buttons above or below. Forward this article to your email lists. Crosspost on your blog site, internet forums. etc.

This article was originally published on The Unz Review.

Mike Whitney is a frequent contributor to Global Research.

Featured image is from The Unz Review

‘Let’s Go Get the Rest of Them Motherf**kers’?

Watch — Leslie Jones After Derek Chauvin Conviction: ‘Let’s Go Get the Rest of Them Motherf**kers’

4,742

https://twitter.com/Lesdoggg/status/1051331510916268032?s=20
Twitter/Lesdoggg

ALANA MASTRANGELO21 Apr 20212,4632:14

https://www.breitbart.com/entertainment/2021/04/21/watch-leslie-jones-after-derek-chauvin-conviction-lets-go-get-the-rest-of-them-motherfkers/

Coming to America 2 actress and host of ABC’s Supermarket Sweep Leslie Jones reacted to the conviction of former Minneapolis police officer Derek Chauvin in a video message to her 1.4 million Twitter followers, saying “Now let’s get the rest of them motherfuckers.”

“Guilty. Guilty. Guilty,” said Jones in a video she posted to Twitter, likely in reference to the three charges in the death of George Floyd, which the jury found Chauvin guilty of on Tuesday.

“Now let’s get the rest of them motherfuckers,” Jones added, in apparent reference to other police officers involved in unfortunate or tragic incidents.

Last summer, after the death of George Floyd, Jones suggested that protesters “vote” in an effort to “burn down this fucking Constitution,” rather than burn down buildings.

“I love that you guys are protesting and see how quick you did it. But I’m gonna tell you, to get the fuck what you really want, we’re going to have to change the fucking system,” she said. “And to change the system, we have to fucking vote.”

“You want to burn down buildings? Burn down this fucking Constitution,” Jones added. “That’s how we really show them.”

Now, nearly a year later, Jones appears to be pleased with the “system” she has previously expressed doesn’t work, as she celebrates the jury’s verdict, and suggests the system should be used to “get the rest of them motherfuckers.”

In 2017, Jones slammed President Donald Trump, stating, “I want to be in love — I want to do that, but it’s 2017, and we got a pig in office. The world is about to end” during a politically charged stand-up comedy set.

In 2018, Jones faced fire from the Baltimore City Fraternal Order of Police which criticized Saturday Night Live for lampooning the city’s police officers. The sketch, entitled “Traffic Stop, saw Jones and other cast members dressed as police who flirt with and sexually harass a male driver.

You can follow Alana Mastrangelo on Facebook and Twitter at @ARmastrangelo, on Parler @alana, and on Instagram.

Gavin Newsom Forces Latinos to Vaccinate

California dictator Gavin Newsom is now using lock downs and RACISM to force 4 million Latinos to vaccinate

03/10/2021 / By Lance D Johnson

https://www.vaccines.news/2021-03-10-newsom-using-lock-downs-to-force-millions-latinos-to-vaccinate.html

Gavin Newsom, the tyrannical dictator over California, is about to lose his title of “governor.” Before he is removed from power, he is trying all he can to threaten freedom in the state and to force certain races of people to vaccinate. Newsom says the people of California will not be able to go back to normal until 2 million Latinos are fully vaccinated according to the current CDC guidelines.

As part of the state’s “equitable” distribution of covid-19 vaccinations, California public health officials have allocated 40 percent of the state’s vaccine lot to the Latino communities in Central Valley and in pockets of Los Angeles. Gavin Newsom is threatening to hold down the livelihoods of people throughout the state, in a desperate attempt to divide people by race and pressure Latinos to take the vaccines.

Gavin Newsom racially profiles Latinos, forcing them to vaccinate in high numbers in order for people to have their freedoms back

Instead of seeking repentance for his tyrannical actions over the past year, Gavin Newsom is trying to shift the blame for his perpetual lockdowns by shaming people who don’t get the experimental vaccines. The first group that Newsom seeks to shame and racially profile are the Latinos, who live mostly in low-income areas, where infection data is high and where healthcare systems are failing.

Newsom refuses to take accountability for his perpetual lockdown policies, which have needlessly upended countless lives. The only way out for Newsom and these corrupt public health figures is to use the lockdowns once more to deprive people of their rights and segregate certain races and demographics, coercing them to give up their bodily autonomy.

State Health and Human Services Director, Dr. Mark Ghaly, said the state won’t reopen until the shots are in the arms. If Latinos do not submit themselves in higher numbers, then California will stay locked down. “As we achieve higher levels of vaccine in the hardest hit communities, we feel more confident that more and more activities across the state can occur,” he said in a recent press briefing. This is what the lockdowns were for. They weren’t a benign 14-day break, to “slow the spread.” They weren’t put in place to prevent peak capacity of hospitals. The lockdowns are to abuse people in every facet of life, until they submit their bodies en masse to the pharmaceutical companies. (Related: Biden orders TROOPS to administer coronavirus vaccines in California as military is repurposed for genocide.)

Using threats and coercion, California targets specific races and neighborhoods, giving rise to a Fourth Reich

The “equitable” distribution plan is not based on compassion, informed consent, or any medical ethic whatsoever. The “equitable” distribution plan is a way to target specific demographics and races, to put pressure on them to comply. Vaccination is no longer respected as an individual choice, with comprehensive, informed consent. Vaccination is being rolled out in stages, lumping people in herds, so they are more likely to be pressured by their peers and coerced to comply. By hinging the state’s freedom on one race’s compliance to the vaccines, a Fourth Reich is officially born.

In California, lockdowns are broken down into “reopening tiers” as state officials promise freedom in stages. These reopening tiers dictate business operations and school re-openings. Californians are being spoon-fed their freedom, as long as a certain percentage of the population complies with vaccinations. This color-based tier plan is now putting people of color in its cross-hairs, forcing them to comply in order for Californians to get some of their freedom back.

This level of coercion is racist, illegal and in violation of basic medical ethics and the Nuremberg treaty. With this level of coercion in place, state officials believe they will get 1.6 million people to comply with a first round of shots in the next two weeks. Officials do not consider this amount of vaccination sufficient to green-light “reopening tiers” across the state. Public health officials demand that the state will not get some of its freedoms back until 4 million doses of vaccine are received in the arms of Latinos in the targeted neighborhoods.

Sources include:

PJMedia.com

NaturalNews.com

If She Only Had a Brain…How She Ever Got Her Position, Is a Wonder

AOC Says Calling Border Crisis a ‘Surge’ Part of ‘White Supremacist Philosophy’

71

Rep. Alexandria Ocasio-Cortez (D-NY) speaks at a news conference introducing the 'People’s Housing Platform' on Capitol Hill on January 29, 2020 in Washington, DC. (Mario Tama/Getty Images)
Mario Tama/Getty Images

NATE CHURCH31 Mar 20212062:09

https://www.breitbart.com/politics/2021/03/31/aoc-says-calling-border-crisis-surge-part-white-supremacist-philosophy/

Rep. Alexandria Ocasio-Cortez (D-NY) said calling illegal immigration a “surge” is part of a racist narrative in an Instagram Live AMA Tuesday.

Democrat “squad” member, Ocasio-Cortez, responded to a question regarding her seeming avoidance of the ongoing border crisis now that former President Trump has left office. On an Instagram Live “Ask Me Anything” session with her followers, Rep. Ocasio-Cortez paused to condemn labeling the crisis a “surge.”

When a viewer asked Ocasio-Cortez why was no longer “addressing the border crisis and the kids in cages like you used to,” she paused for a moment. “It’s not a border crisis. It’s an Imperialism crisis, it’s a climate crisis, it’s a trade crisis. And also it’s a carceral crisis,” she said.

“But people don’t want to have that conversation,” AOC continued. “They want to say, ‘But what about the surge?’” Then she called for a “gut check,” saying “Stop. Anyone who’s using the term ‘surge’ around you, consciously, is trying to invoke a militaristic frame.”

“And that’s a problem, because this is not a surge. These are children and they are not insurgents and we are not being invaded,” she continued. She called the idea and its language part of “a white supremacist philosophy,” criticizing “the idea that if another is coming in the population that this is an invasion of who we are.”

Marine veteran and Townhall.com senior writer Julio Rosas disagreed. “I’ve been using the term “surge” because there’s a higher than usual amount of people illegally crossing into the U.S.,” Rosas tweeted Tuesday night. And unlike AOC, Rosas said he had “seen it with my own eyes on a nightly basis for the past week.”

“Yes, there are kids here, often by themselves. It’s emotionally taxing to see that night after night because God only knows what they’ve been through,” Rosas continued. “Funny how AOC raced down to TX for the winter storm but she can’t be bothered to come down now to see what’s happening.”

ImmigrationPoliticsSocial JusticeAlexandria Ocasio-CortezAOCBorder Crisis

Another False Flag To Add To The List!

The Highwayman

You really don’t think that this event in the Suez canal was an ACCIDENT… do you?

They say that it won’t be long before the rest of the world realizes the economic impact from this debacle… but, is it REALLY  a debacle or is it just another globalist-planned crisis like the Covid scam to further fuck with society and bring it to a grinding halt at their feet?  It’s the latter, folks, you can bet the farm on it.

These megalomaniacal bastards know no restraints, their plans for world government have been in the works for thousands of years, a multi-generational scheme to control it ALL.  Up to now, their movements have been relatively slow, but, things are heating up fast.  They know the time is ripe for the take-over, society has never been more compliant than it is, today.  People will believe anything and put up with anything rather…

View original post 377 more words

Massive Lawsuit Announced to Challenge Private Federal Reserve Secrecy

EXCLUSIVE: Massive Lawsuit Announced to Challenge Private Federal Reserve Secrecy

Infowars.com

March 25th 2021, 5:55 pmConstitutional lawyer Robert Barnes announces plan to use FOIA process to force audit the Fed.Image Credit:OLIVIER DOULIERY/AFP via Getty ImagesSHARE

Fund the InfoWar. Donate Now!Keep up to date with our latest:EMAILSign Up NowHave an important tip? Let us know.EMAIL US HERE.

Robert Barnes gives The Alex Jones Show the exclusive breaking news about a new lawsuit to challenge the private Federal Reserve’s secrecy.https://api.banned.video/embed/605cee1bdccdd161300756b6

Visit https://vivabarneslaw.locals.com/ for more information.

Democrats Words, Lead to Mass Shootings

How to Reduce or Eliminate Mass Shootings

Thomas DiLorenzo

About three weeks ago the Demo-Bolsheviks announced that they were starting a new attack on the Second Amendment with a push for more gun-control laws that would further disarm law-abiding citizens (the only ones who would obey such laws).  Then there were two widely-publicized mass shootings in Atlanta and Boulder (unlike the not-so-publicized daily mass shootings in Chicago, Baltimore, Atlanta, and other heavily “gun-controlled” Demo-Bolshevik-run cities).

Obviously, the way to reduce or eliminate mass shootings is to get the Demo-Bolsheviks to stop threatening to destroy the Second Amendment once and for all. It seems like every time they make an announcement like this, sure enough, there is then a mass shooting that (they think) bolsters their case.

Wisconsin Approves Election Invist

Wisconsin State Assembly Approves 2020 Election Investigation March 24, 2021 | Sundance | 368 Comments

The Wisconsin state legislature has passed a resolution authorizing an official investigation into the 2020 election in the badger state.  The resolution allows for evidence gathering and subpoena power for witness depositions.

Via Associated Press – MADISON, Wis. (AP) — The Republican-controlled Wisconsin Assembly passed a resolution Tuesday to authorize an investigation into the 2020 presidential election that President Joe Biden narrowly won in the state.

The resolution, opposed by Democrats, is needed to give the committee authorization if it decides to issue subpoenas to compel testimony and gather documents, said Rep. Joe Sanfelippo. He is vice-chairman of the Assembly elections and campaign committee that would conduct the probe.

The resolution authorizing the investigation passed on a 58-35 party line vote, with all Republicans in support and all Democrats against. It passed after Republicans last month ordered an audit of the election results. (read more)

Trump Rally Wisconsin, November 2, 2020 Posted in 1st Amendment, Big Government, Big Stupid Government, Conspiracy ?, Donald Trump, Election 2020, Joe Biden, media bias, President Trump, Uncategorized

U.S. Health Officials Accuse AstraZeneca of Misrepresenting Efficacy Data

03/23/21•

BIG PHARMA › NEWS

U.S. Health Officials Accuse AstraZeneca of Misrepresenting Efficacy Data

An independent trial review board says AstraZeenca may have included outdated information about its clinical trial results in a press release.By Megan Redshaw

Link copied

In a “highly unusual” statement Tuesday, a U.S. health agency said AstraZeneca may have included “outdated information” in its clinical trial results, which may have led to the vaccine maker providing the public with an incomplete view of its efficacy data.

The statement by the National Institute of Allergy and Infectious Diseases (NIAID) came less than a day after the pharmaceutical company said its vaccine was 79% effective against COVID and 100% effective against severe or critical disease and hospitalization.

“We urge the company to work with the Data and Safety Monitoring Board (DSMB) to review the efficacy data and ensure the most accurate, up-to-date efficacy data be made public as quickly as possible,” the NIAID said.

AstraZeneca immediately responded saying the numbers published Monday were based on a “pre-specified interim analysis with a data cut-off” of Feb. 17. The company promised to “immediately engage with the DSMB to share their primary analysis with the most up-to-date efficacy data” and to issue the results of the primary analysis within 48 hours.

The DSMB is an independent expert group that sees trial data before the pharmaceutical companies, the doctors running the trials or even the U.S. Food and Drug Administration (FDA), according to CNN. It has the authority to advise a company of positive interim findings or to halt a trial over safety concerns, which is what happened to AstraZeneca last September after a study participant developed neurological symptoms.

In an interview with Good Morning America, NIAID Director Dr. Anthony Fauci explained the sequence of events. Fauci said that the DSMB and AstraZeneca reviewed the trial data together before the vaccine maker issued its press release. But when AstraZeneca issued its press release, the DSMB “got concerned and wrote a rather harsh note to them and with a copy to me saying that in fact the data that was in the press release were somewhat outdated and might in fact be misleading a bit and wanted them to straighten it out.”

That’s when NIAID issued its statement advising AstraZeneca that it “better get back with the DSMB to make sure that the correct data gets put into a press release,” Fauci said. Fauci said that DSMB picking up this discrepancy is really “a safeguard.”

In a statement to the Science Media Centre in the UK, Stephen Evans, professor of pharmacoepidemiology at the London School of Hygiene and Tropical Medicine, said that members of the DSMB sometimes disagree with investigators over vaccine trial results, but usually in private. “So this is unprecedented in my opinion,” Evans said.

  • As analysts scrambled to interpret the statement, one scientist claimed the U.S. government stopped just short of accusing AstraZeneca of manipulating its trial data.

“This is a highly unusual statement by the U.S. National Institute of Allergy and Infectious Diseases (NIAID). It comes close to accusing Oxford/AZ of having wilfully misrepresented some results from their recent U.S. vaccine trial,” tweeted Francois Balloux, professor and director of the UCL Genetics Institute.https://platform.twitter.com/embed/Tweet.html?dnt=false&embedId=twitter-widget-0&frame=false&hideCard=false&hideThread=false&id=1374230777601388546&lang=en&origin=https%3A%2F%2Fchildrenshealthdefense.org%2Fdefender%2Fastrazeneca-misrepresenting-efficacy-data%2F&siteScreenName=ChildrensHD&theme=light&widgetsVersion=e1ffbdb%3A1614796141937&width=550px

According to The New York Times, companies sponsoring drug or vaccine trials typically wait for the monitoring board to review analyses and conclude that the study has yielded an answer before they announce trial results.

In recent days, the monitoring board’s analysis of the AstraZeneca trial was delayed several times because the board asked for revised reports from those handling trial data on behalf of the company. The monitoring board ultimately conveyed the results of the study to AstraZeneca in a meeting over the weekend, leading to the company’s press release Monday morning.

Dr. Eric Topol, a clinical trials expert at Scripps Research in San Diego, said it was “highly irregular” to see such a public display of friction between a monitoring board and a study sponsor. “I’ve never seen anything like this,” he told the Times after the institute’s statement was released. “It’s so, so troubling.”

According to Zero Hedge, the AstraZeneca vaccine — which is a linchpin of the World Health Organization’s effort to vaccinate poorer countries via its Bill Gates-approved COVAX initiative — once again finds itself mired in controversy. Notably, in its most recent data, AstraZeneca neglected to include key information, such as  the number of trial participants who developed “severe COVID.” AstraZeneca President Ruud Dobber, during an interview on CNBC’s Squawk Box, said the number was “5,” shortly after the data were released.

“The way they handled their data early on, AstraZeneca basically shot themselves in the foot,” Julian Tang, a virologist at the University of Leicester, said even before the latest issue arose.

AstraZeneca has received criticism over its studies since the first data released in the UK, which purported to show the vaccine was 70% effective, yet failed to account for a manufacturing mistake and didn’t include enough participants over 65 to determine efficacy among older patients, reported ZeroHedge.

European governments like Germany and France responded by initially limiting the jab to patients under the age of 65. In the U.S., officials suspended AstraZeneca’s study in 30,000 Americans for an unusual six weeks last fall, as frustrated regulators sought details about neurological problems reported in Britain.

The latest controversy comes after 20 countries suspended use of AstraZeneca last week based on reports of rare blood clots, some resulting in death, in healthy people who received the vaccine. Although The European Medicines Agency (EMA) found the Oxford-AstraZeneca COVID vaccine “may be associated with very rare cases of blood clots,” it deemed the vaccine “safe and effective” and encouraged countries to use it, The Defender reported.

Two independent research teams in Norway and Germany announced Friday they identified antibodies that provoke immune reactions leading to the type of blood clots experienced by some people who received AstraZeneca’s COVID vaccine. Although many countries resumed their vaccination program with AstraZeneca’s vaccine after the EMA’s preliminary findings, some countries, including France, Denmark, Norway, Sweden and Finland, have not lifted their restrictions on its use, according to The British Medical Journal.

AstraZeneca said it would continue to analyze the new data and prepare to apply in the coming weeks for Emergency Use Authorization (EUA) from the FDA, reported the Times. If approved in the U.S. AstraZeneca would become the fourth available vaccine stateside, joining ModernaPfizer and Johnson & Johnson.

We Get Crumbs… — Freedom Is Just Another Word…

And Federal employees get!!! Americans Will Get $1,400 Once from Dem COVID Relief Bill, Federal Workers Can Get $21,000 Of taxpayers money… “Under the bill as currently drafted, full-time federal employees can take up to 600 hours in paid leave until September 30, up to $35 an hour and $1,400 a week. That’s 15 weeks […]

We Get Crumbs… — Freedom Is Just Another Word…

Government Dependence

27% Of All Household Income In The US Now Comes From The Government

Tyler Durden's Photoby Tyler DurdenFriday, Feb 26, 2021 – 11:45

https://www.zerohedge.com/markets/27-all-household-income-us-now-comes-government

Following today’s release of the latest Personal Income and Spending data, Wall Street was predictably focused on the changes in these two key series, which showed a surge in personal income (to be expected in the month when the $900BN December 2020 stimulus hit), coupled with a far more modest increase in personal spending.

But while the change in the headline data was notable, what was far more remarkable was data showing just how reliant on the US government the population has become.Recommended VideosGoogle Launches Stadia Gaming Platform  

https://imasdk.googleapis.com/js/core/bridge3.444.1_en.html#goog_333981534 Now Playing Google Launches Stadia Gaming Platform Up Next One Punch Man: A Hero Nobody Knows: Street Date Announcement Trailer (PS4) Overwatch 2 – Gameplay Trailer Big carmakers get serious about esports Story of a Gladiator – Launch Trailer Facetime-style Word Game Seeks to Connect Players Paladins – Tiberius, The Weapon’s Master – Cinematic Trailer One Piece: Pirate Warriors 4: Release Date Announcement Trailer (Xbox One)

We are referring, of course, to Personal Current Transfer payments which are essentially government sourced income such as unemployment benefits, welfare checks, and so on. In January, this number was $5.781 trillion annualized, which was not only up by nearly $2 trillion from the $3.8 trillion in December it was also $2 trillion above the pre-Covid trend where transfer receipts were approximately $3.2 trillion.

This means that excluding the $2 trillion annualized surge in govt transfers, personal income excluding government handouts actually declined by $22.3BN from $15.696TN to $15.673TN, hardly a sign of a healthy, reflating economy.

Shown in longer-term context, one can see the creeping impact of government payments, shown in red below.

This, as noted earlier, was due to the latest round of government stimulus checks hitting personal accounts which in turn helped push the savings rate to a whopping 20.5% from 13.4% at the end of 2020.

Stated simply, what all this means is that the government remains responsible for over a quarter of all income, or 26.9 to be precise!

Imagine what that income chart will look like after Biden’s $1400 checks go out?

Putting that number in perspective, in the 1950s and 1960s, transfer payment were around 7%. This number rose in the low teens starting in the mid-1970s (right after the Nixon Shock ended Bretton-Woods and closed the gold window). The number then jumped again after the financial crisis, spiking to the high teens.

And now, the coronavirus has officially sent this number into the mid-20% range, after hitting a record high 31% in April.

And that’s how creeping banana republic socialism comes at you: first slowly, then fast.

So for all those who claim that the Fed is now (and has been for the past decade) subsidizing the 1%, that’s true, but with every passing month, the government is also funding the daily life of an ever greater portion of America’s poorest social segments.

Who ends up paying for both?

Why the middle class of course, where the dollar debasement on one side, and the insane debt accumulation on the other, mean that millions of Americans content to work 9-5, pay their taxes, and generally keep their mouth shut as others are burning everything down and tearing down statues, are now doomed.

The “good” news? As we reported last November, the US middle class won’t have to suffer this pain for much longer, because while the US has one one of the highest median incomes in the entire world, with only three countries boasting a higher income, it is who gets to collect this money that is the major problem, because as the chart also shows, with just a 50% share of the population in middle-income households, the US is now in the same category as such “banana republics” as Turkey, China and, drumroll, Russia.

What is just as stunning: according to the OECD, more than half of the countries in question have a more vibrant middle class than the US.

So the next time someone abuses the popular phrase  “they hate us for our [fill in the blank]”, perhaps it’s time to counter that “they” may not “hate” us at all, but rather are making fun of what has slowly but surely become the world’s biggest banana republic?

And as we concluded last year, “it has not Russia, nor China, nor any other enemy, foreign or domestic, to blame… except for one: the Federal Reserve Bank of the United States.”

Discrimination

Media Silent as Biden Illegally Holds Unaccompanied Migrant Children, Says Border Patrol Union

75,985

Young detainees sleep in a U.S. Customs and Border Protection holding cell in Brownsville, Texas. More than 50,000 unaccompanied migrant kids have been detained in the last eight months, an almost 100 percent increase from the previous fiscal year. (AP File Photo: Eric Gay)
AP File Photo: Eric Gay

BOB PRICE23 Feb 202111,4725:05

The mainstream media is being silent as the Biden administration holds unaccompanied migrant children in Border Patrol custody longer than legally allowed, the head of the Border Patrol union stated. The minors are being held in the same “cages” the media and Democrat politicians loudly criticized the Trump administration for.

National Border Patrol Council President Brandon Judd told Breitbart Texas that as of Monday, Border Patrol officials held more than 800 Unaccompanied Alien Children (UAC) in custody. Despite the legal requirement to release the children to other federal agencies within 72 hours, more than 212 remained in custody longer than the legal limit.

“Today, [White House Press Secretary] Jen Psaski said the Administration could not hold the children in other locations due to the Covid protocols including social distancing,” Judd told Breitbart, “but what she didn’t tell the media was that the children in [Border Patrol’s] custody were being held in conditions that have nearly no way to social distance.”

Psaki’s remarks came in a Tuesday press briefing in response to questions from Fox News White House Correspondent Peter Doocy. Forbes tweeted a video of the exchange.https://platform.twitter.com/embed/Tweet.html?creatorScreenName=BobPriceBBTX&dnt=false&embedId=twitter-widget-0&frame=false&hideCard=false&hideThread=false&id=1364268287656407040&lang=en&origin=https%3A%2F%2Fwww.breitbart.com%2Fborder%2F2021%2F02%2F23%2Fmedia-silent-as-biden-illegally-holds-unaccompanied-migrant-children-says-border-patrol-union%2F&siteScreenName=BreitbartNews&theme=light&widgetsVersion=889aa01%3A1612811843556&width=550px

To be clear, Judd states that the Biden administration is holding unaccompanied minors in Border Patrol custody longer than the law allows in conditions where social distancing cannot be maintained in order to keep social distancing in other federal facilities.

“The hypocrisy from the left and the mainstream media truly shows they care nothing for the children they used as pawns to attack President Trump.”  Judd said.

“Today Jen Psaski said ‘Customs and Border Control’ [not Customs and Border Protection] continue to transfer unaccompanied children to HHS’ Office of Refugee and Resettlement (ORR),” the Border Patrol union leader explained. “She went to great lengths to explain that due to the pandemic and social distancing, ORR only has capacity for a certain number of children.”

“What she didn’t explain is that the children that ORR doesn’t have that capacity to take are left in facilities far worse than those of HHS,” Judd continued. “In fact, they are being held in the same locations they accused the Trump Administration of inhuman acts when they said he was holding ‘kids in cages.’”https://platform.twitter.com/embed/Tweet.html?creatorScreenName=BobPriceBBTX&dnt=false&embedId=twitter-widget-1&frame=false&hideCard=false&hideThread=false&id=1362207461869051906&lang=en&origin=https%3A%2F%2Fwww.breitbart.com%2Fborder%2F2021%2F02%2F23%2Fmedia-silent-as-biden-illegally-holds-unaccompanied-migrant-children-says-border-patrol-union%2F&siteScreenName=BreitbartNews&theme=light&widgetsVersion=889aa01%3A1612811843556&width=550px

U.S. Representative Alexandria Ocasio-Cortez (D-NY) attacked the Biden administration for their expanded policy of opening detention facilities in South Texas, Breitbart’s John Binder reported.

“This is not okay, never has been okay, never will be okay — no matter the administration or party,” the New York congresswoman wrote.

Despite shortages of detention space, the Biden administration, through the U.S> Border Patrol, issued instructions to immediately release migrants in South Texas in order to deal with overcrowding in temporary holding facilities, Breitbart’s Randy Clark reported Tuesday night.

The continuing increase in the apprehension of unaccompanied minors is creating a crisis for the Biden administration along the Southwest border.

The number of Unaccompanied Alien Children illegally crossing the border from Mexico into the U.S. is increasing from month to month, according to reports from U.S. Customs and Border Protection officials. In January 2021, Border Patrol agents apprehended 5,871 unaccompanied minors. This is up from 4,995 in December 2020 and 3,076 in January 2020.

Breitbart Texas reached out to U.S. Customs and Border Protection and Border Patrol for confirmation of the numbers of migrants being held in custody by Border Patrol and how long they are being held. An immediate response from officials was not available by the time of this article’s publication.

Bob Price serves as associate editor and senior news contributor for the Breitbart Texas-Border team. He is an original member of the Breitbart Texas team. Price is a regular panelist on Fox 26 Houston’s Sunday-morning talk show,What’s Your Point? Follow him on Twitter @BobPriceBBTX, Parler @BobPrice, and Facebook.

Border / Cartel ChroniclesMediaPoliticsBrandon JuddJen PsakiNational Border Patrol CouncilPeter Doocyunaccompanied alien childrenUnaccompanied Minors

Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse

https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html#

Bypass censorship by sharing this link:

New

https://www.afinalwarning.com/495900.html Copy URL 30KViews

Image: Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse

(Natural News) America as we know it is over. President Trump is the last president of the United States of America. Fake president Joe Biden wasn’t elected by the people and isn’t a real president, so his fake regime doesn’t count.

Beyond all the politics and cyber warfare and criminal vote fraud carried out by Democrats, what is the real root cause of the fall of America? As I explain in today’s podcast, it really comes down to mass mental illness.

Over half the people in America are mentally poisoned to the point of clinical insanity, and it is these people who attempt to run the government, the fake news outlets, the CDC and public schools, all like some twisted scene out of Idiocracy where even the Secretary of Education is a complete moron.

We’ve already passed the Idiocracy tipping point in America, of course. Fake White House press secretary Jen Psaki is a moron. Fake president Joe Biden has advanced dementia. None of the Democrats in the U.S. Senate can recognize reality anymore, and they function almost entirely as brainwashed bio-puppets who do whatever they’re told. (Which is what NPCs do, of course.) Meanwhile, the people who voted for Biden suffer from the mental illness / cult brainwashing of “progressivism” which is rooted in irrationality, learned hatred and denial of reality.

But what caused all this mass mental illness? It’s not difficult to identify the vectors of the poisoning:

When you put all this together, you realize that a majority of Americans are now cognitively poisoned beyond the point of rationality. Recently, a woman who ran out of hair spray spread Gorilla Glue across her entire head and then couldn’t figure out why the glue wouldn’t wash out in the shower. But that’s not the mass mental illness I’m referring to.

In response to this, people donated $15,000 to her GoFundMe account, and nearly 700,000 followers joined her on Instagram, so the woman has now hired a manager. This is the mass mental illness of the population being demonstrated, where people are attracted to insanity and stupidity and end up supporting it. It really is like a scene ripped right out of Idiocracy.

Here’s a short Brighteon video explaining this fascinating demonstration of total madness and stupidity. It’s too bad Democrats won’t try to use Gorilla Glue as lipstick, so they might glue all their lips shut and stop filling the world with stupidity:

https://www.brighteon.com/embed/88d31489-0456-4e2f-b2e3-c1cdfce48972

In today’s important Situation Update, I reveal why America is over and how the globalists will likely succeed in mass murdering six billion people. It doesn’t look like a process we can stop.

It’s also apparent that the masses are either too stupid or too insane to have any idea what’s happening to them. The Bill Gates effort to mass murder six billion people won’t be difficult for globalists to achieve. Do you really think “Gorilla Glue girl” has any clue that the global depopulation agenda is targeting people like her, whom globalists label “useless eaters?”

Meanwhile, Big Tech censors intelligent people like Sherri Tenpenny or Dr. Joseph Mercola, while promoting the content of idiots who use industrial glue as a hair gel. What’s next? Will she use Gorilla Glue as a food thickener in her macaroni and cheese, and then wonder why she has a stomach ache?

Yet her story isn’t unusual anymore. People are insane everywhere, and that includes US senators, so-called “journalists” and even the “authorities” at the FDA or CDC.

We are no longer living in a world ruled by rationality, morality and clear thinking. The world has collapsed into insanity, immorality and demonism.

This is why America as we know it is over. The genocidal globalists will “win” in their effort to slaughter billions. But after the coming collapse and mass genocide, there will be a “next society” for the survivors, most of whom will be preppers and anti-vaxxers because that’s who is prepared to survive the global culling.

We must all prepare to survive the mass culling and then contribute to the society that emerges on the other side.

Also, there will be no more traffic jams or difficulty finding parking, just fyi.

Brighteon.com/230c068b-2e3b-44e4-9f4f-6f797a1d3b46

https://www.brighteon.com/embed/230c068b-2e3b-44e4-9f4f-6f797a1d3b46

Hear each day’s new podcast at:

https://www.brighteon.com/channels/hrreportPrevious :Natural News launches TOR browser (.onion) website to bring natural health and nutrition knowledge to the dark webNext : Situation Update, Feb. 11th – Environmental groups call out Bill Gates for insanely dangerous global terraforming scheme 30KViews

Receive Our Free Email Newsletter

Get independent news alerts on natural cures, food lab tests, cannabis medicine, science, robotics, drones, privacy and more. https://www.naturalnews.com/Include-ReaderRegistration-2019-Subscribe-Form-UnderArticle.html

More news on brain function

Reducing your sugar intake will help improve your sleep quality and food choicesStudy: Walking slowly may be a sign of “accelerated aging” and that you’re more likely to get sick later in lifeHere’s how you can boost your dopamine levels naturallySituation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapseStudy: Trans fats linked to poor brain health and greater risk of dementia and Alzheimer’sA diet high in trans fats linked to a significantly higher risk of dementia among the elderlyCan abdominal pain affect brain function?Musk mallow seeds can protect the brain against degeneration caused by fluoride toxicityCompounds from two Nigerian vegetables found to inhibit enzymes implicated in neurodegenerative diseasesStudy explains how a chemical from Japanese cornel may help treat Alzheimer’s disease

About the author: Mike Adams (aka the “Health Ranger“) is a best selling author (#1 best selling science book on Amazon.com called “Food Forensics“), an environmental scientist, a patent holder for a cesium radioactive isotope elimination invention, a multiple award winner for outstanding journalism, a science news publisher and influential commentator on topics ranging from science and medicine to culture and politics. Follow his videos, podcasts, websites and science projects at the links below.

Mike Adams serves as the founding editor of NaturalNews.com and the lab science director of an internationally accredited (ISO 17025) analytical laboratory known as CWC Labs. There, he was awarded a Certificate of Excellence for achieving extremely high accuracy in the analysis of toxic elements in unknown water samples using ICP-MS instrumentation. Adams is also highly proficient in running liquid chromatography, ion chromatography and mass spectrometry time-of-flight analytical instrumentation. He has also achieved numerous laboratory breakthroughs in the programming of automated liquid handling robots for sample preparation and external standards prep.

The U.S. patent office has awarded Mike Adams patent NO. US 9526751 B2 for the invention of “Cesium Eliminator,” a lifesaving invention that removes up to 95% of radioactive cesium from the human digestive tract. Adams has pledged to donate full patent licensing rights to any state or national government that needs to manufacture the product to save human lives in the aftermath of a nuclear accident, disaster, act of war or act of terrorism. He has also stockpiled 10,000 kg of raw material to manufacture Cesium Eliminator in a Texas warehouse, and plans to donate the finished product to help save lives in Texas when the next nuclear event occurs. No independent scientist in the world has done more research on the removal of radioactive elements from the human digestive tract.

Adams is a person of color whose ancestors include Africans and American Indians. He is of Native American heritage, which he credits as inspiring his “Health Ranger” passion for protecting life and nature against the destruction caused by chemicals, heavy metals and other forms of pollution.

Adams is the author of the world’s first book that published ICP-MS heavy metals analysis results for foods, dietary supplements, pet food, spices and fast food. The book is entitled Food Forensics and is published by BenBella Books.

In his laboratory research, Adams has made numerous food safety breakthroughs such as revealing rice protein products imported from Asia to be contaminated with toxic heavy metals like lead, cadmium and tungsten. Adams was the first food science researcher to document high levels of tungsten in superfoods. He also discovered over 11 ppm lead in imported mangosteen powder, and led an industry-wide voluntary agreement to limit heavy metals in rice protein products.

In addition to his lab work, Adams is also the (non-paid) executive director of the non-profit Consumer Wellness Center (CWC), an organization that redirects 100% of its donations receipts to grant programs that teach children and women how to grow their own food or vastly improve their nutrition. Through the non-profit CWC, Adams also launched Nutrition Rescue, a program that donates essential vitamins to people in need. Click here to see some of the CWC success stories.

With a background in science and software technology, Adams is the original founder of the email newsletter technology company known as Arial Software. Using his technical experience combined with his love for natural health, Adams developed and deployed the content management system currently driving NaturalNews.com. He also engineered the high-level statistical algorithms that power SCIENCE.naturalnews.com, a massive research resource featuring over 10 million scientific studies.

Adams is well known for his incredibly popular consumer activism video blowing the lid on fake blueberries used throughout the food supply. He has also exposed “strange fibers” found in Chicken McNuggets, fake academic credentials of so-called health “gurus,” dangerous “detox” products imported as battery acid and sold for oral consumption, fake acai berry scams, the California raw milk raids, the vaccine research fraud revealed by industry whistleblowers and many other topics.

Adams has also helped defend the rights of home gardeners and protect the medical freedom rights of parents. Adams is widely recognized to have made a remarkable global impact on issues like GMOs, vaccines, nutrition therapies, human consciousness.

In addition to his activism, Adams is an accomplished musician who has released over fifteen popular songs covering a variety of activism topics.

Click here to read a more detailed bio on Mike Adams, the Health Ranger, at HealthRanger.com.

Find more science, news, commentary and inventions from the Health Ranger at:

Brighteon.com:
Brighteon.com/channel/hrreport

Diaspora: (uncensored social network)
Share.NaturalNews.com

GAB:
GAB.com/healthranger

Podcasts:
HealthRangerReport.com

Online store:
HealthRangerStore.com

#1 Bestselling Science Book Food Forensics:
FoodForensics.com

iTunes:
itunes.apple.com/us/podcast/the-health-ranger-report/id1063165791

SoundCloud:
Soundcloud.com/healthranger

Health Ranger’s science lab
CWClabs.com

Health Ranger bio
HealthRanger.com
TruthWiki.org

Search engine:
Webseed.com

Disqus

https://disqus.com/embed/comments/?base=default&f=naturalnews&t_i=nn%3A81615&t_u=https%3A%2F%2Fwww.naturalnews.com%2F2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html&t_d=Situation%20Update%2C%20Feb.%2010th%20%E2%80%93%20How%20America%20ends%3A%20Mass%20mental%20poisoning%20triggers%20tipping%20point%20of%20collapse&t_t=Situation%20Update%2C%20Feb.%2010th%20%E2%80%93%20How%20America%20ends%3A%20Mass%20mental%20poisoning%20triggers%20tipping%20point%20of%20collapse&s_o=default#version=4ce792797f4c10a96525509c741bcf5f

Take Action: Support Natural News by linking to this article from your website

Permalink to this article:
https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html

Embed article link: (copy HTML code below):
<a href=”https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html”>Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse</a>

Reprinting this article:

Non-commercial use OK, cite NaturalNews.com with clickable link.

Follow Natural News on Diaspora, AllSocial, USA.Life, Parler, MeWe, and GAB Most Viewed Articles Today Week Month Year

Reference Information

Science.NaturalNews.com
Conduct powerful scientific research in mere seconds for your book, blog, website article or news report.

NaturalPedia.com
A free online encyclopedia of natural health knowledge from the industry’s top authors and writers.

HealingFoodReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of foods.

HerbReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of herbs.

SupplementReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of supplements.

NutrientReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of nutrients.

HonestFoodGuide.org
This free to download food guide offers genuine nutritional information, not watered-down information designed to boost the sale of milk, beef and grains.

Advertise with NaturalNews… Natural News Wire (Sponsored Content)

Advertise with NaturalNews…

Science.News
Science News & Studies

Medicine.News
Medicine News and Information

Food.News
Food News & Studies

Health.News
Health News & Studies

Herbs.News
Herbs News & Information

Pollution.News
Pollution News & Studies

Cancer.News
Cancer News & Studies

Climate.News
Climate News & Studies

Survival.News
Survival News & Information

Gear.News
Gear News & Information

Glitch.News
News covering technology, stocks, hackers, and more Read Archived NaturalNews StoriesNaturalNews.com

Natural News Toolbar
Privacy Policy
Terms of Use
About Us
Contact Us/Feedback
Write for Natural News
Media Information
Advertise Information Follow Us

Email Newsletter
Brighteon.Social
MeWe
GAB
Diaspora
USA.Life
Parler
RSS

Apple iOS app
Android app on Google Play
eTrust Pro Certified

This site is part of the Natural News Network © 2019 All Rights Reserved. Privacy | Terms All content posted on this site is commentary or opinion and is protected under Free Speech. Truth Publishing International, LTD. is not responsible for content written by contributing authors. The information on this site is provided for educational and entertainment purposes only. It is not intended as a substitute for professional advice of any kind. Truth Publishing assumes no responsibility for the use or misuse of this material. Your use of this website indicates your agreement to these terms and those published here. All trademarks, registered trademarks and servicemarks mentioned on this site are the property of their respective owners. Get the world’s best natural health newsletter delivered straight to your inbox.

x

By con

Watch – Doctor Admits Masks Don’t Work: “All Viruses Can Get Through”

by Adan Salazar February 1st 2021, 1:06 pm ‘I wear a mask so people don’t think I don’t care about them, but I don’t wear a mask because they work.’Image Credit:TwitterShareFund the InfoWar. Donate Now!Keep up to date with our latest:EmailSign Up NowHave an important tip? Let us know.Email us here.

A medical doctor’s lecture explaining face masks aren’t effective at blocking viruses has gone viral.

In the message, a member of America’s Frontline Doctors, Dr. Richard Urso, admits masks block little if any microscopic virus particles, contrary to what mainline health experts have been telling the public.

https://platform.twitter.com/embed/Tweet.html?dnt=true&embedId=twitter-widget-1&frame=false&hideCard=false&hideThread=false&id=1355276143159517184&lang=en&origin=https%3A%2F%2Fwww.infowars.com%2Fposts%2Fwatch-doctor-admits-masks-dont-work-all-viruses-can-get-through%2F&theme=light&widgetsVersion=889aa01%3A1612811843556&width=500px

“We know what works — these don’t work against viruses. Regular masks don’t work. That’s simply what it is,” Urso explains.

“It has nothing to do with Covid. Covid doesn’t even factor into the equation, because for years we’ve been looking at these issues.”

The Texas-based ophthalmologist goes on to explain there are more protective methods which would be more effective, but the N-95 masks recommended to the public still allow virus particles to pass.

“So, they have these spacesuits, they’re called ‘PAPRs,’ they’re incredibly effective, they filter viruses down to .01. Basically we have materials like N-99, N-100, but N-95… only five percent of airborne particles can get through, but all viruses can get through period.”

“Now do they get through? No, it’s just like a chainlink fence. When you throw sand at a chainlink fence not all the sand gets through.”

“So, I think the best example I can say is the reason we wear masks and the reason I wear a mask is because the fear is so massive in this country. I wear a mask so people don’t think I don’t care about them, but I don’t wear a mask because they work.”

Dr. Urso’s message is spreading as NIAID Director Anthony Fauci has once again flip-flopped on masks, at first claiming last week that it was “common sense” to wear two, or even up to three masks. Over the weekend, however, Dr. Fauci claimed there was “no data” to indicate that wearing two masks “would make a difference.” https://platform.twitter.com/embed/Tweet.html?dnt=true&embedId=twitter-widget-2&frame=false&hideCard=false&hideThread=false&id=1355991619225448450&lang=en&origin=https%3A%2F%2Fwww.infowars.com%2Fposts%2Fwatch-doctor-admits-masks-dont-work-all-viruses-can-get-through%2F&theme=light&widgetsVersion=889aa01%3A1612811843556&width=500px


Follow the author on Gab: https://gab.ai/adansalazar
On Twitter: https://platform.twitter.com/widgets/follow_button.6e189c4f2b6d88c453045806323cdcf3.en.html#dnt=true&id=twitter-widget-0&lang=en&screen_name=AdanSalazarWins&show_count=false&show_screen_name=true&size=m&time=1613023157347
On Parler: https://parler.com/profile/adansalazar/
On Facebook: https://www.facebook.com/adan.salazar.735
On Minds: https://www.minds.com/adan_infowars https://api.banned.video/embed/60176d089942cd18bc5c2190

BOMBSHELL: MAJOR GOVERNMENTS SAY COVID-19 VACCINE A FRAUD

Read and you decide what is real

writing from an Ed Curtis in North Dakota. His website is https://thefax.webs.com/ – previous ones were lost, according to him

GODS 10 COMMANDMENTS

  1. I am the LORD your God: you shall not have strange Gods
    before me.
  2. You shall not take the name of the LORD your God in vain.
  3. Remember to keep holy the LORD’S Day.
  4. Honor your father and your mother.
  5. You shall not kill.
  6. You shall not commit adultery.
  7. You shall not steal.
  8. You shall not bear false witness against your neighbor.
  9. You shall not covet your neighbor’s wife.
  10. You shall not covet your neighbor’s goods.
    First they came for the kids, The dim druggies, and the handicap and I
    kept quiet,

Then they came for the Jews and I wasn’t a Jew so I remained silent.
Then they came for the Gypsies, criminals, and inferior races, and it was best to remain quiet so I did. When they came for the Catholics, I was too afraid to say anything and didn’t, I could only pray. Then They came for me and there was no one left to protect me from them. Nazi Germany 1932

First we rounded up the Indians and rallied around the troops and the taking of the lands for a few beads and bottles, we took all the land as we all agreed, they were savages, they didn’t deserve it and it all was ours to take.
We gave out diseased blankets, mass starvation s, war and winter marches to all of “THEM “. We took the lands and saved us all from “savages”. For the good of us all but them. We made heroes of those who did the dirty work and we fed and paid them well and off to sleep we went, We were all safe once again.
Then again we were woken to rally up the troops to save us all for THEM, The ones who needed slaves to work the fields Was the enemy of man. We came to free the slaves. Until we took the step forward and invented better machinery or was it until the secrets of slavery became un-cool, too easy to see? It was time to advance the plan, and a new game plan was hatched as our leaders became more educated and refined. Our rulers learned to hide from us in plain site and play us all like fools to support all of them. We advanced our thinking a little and made it ineffective, so they took a step back until we went to sleep again. In the two-step dance, they always play with your life you were never trained to see. We could not argue, We all were in the wrong, letting some keep slaves. Again, a new game plan was born, it took a Civil war to free all of THE people who we had let become enslaved to Work in the fields. Somehow They tricked us and took us ALL in instead. With contracts of forgery and of fraud, and the new deal was off and running. We all became the slaves in their plan and ensured their class would thrive until they reached the grave. Next, they came for the drunks in the days of probation. They found gold mines and power
with new ways to make a buck in a war with all of US. They promoted all the terrible crimes caused by all THEM drunks! The making of crime and criminals plan really moved ahead! But the people were not quite so asleep as yet and it didn’t last very long, 3 steps forward then one back, the safe way to conquer the world. Many were killed but not us this time so we went back to bed. They slowed the game down, We were told “Don’t worry about a thing” and they quietly planned ahead.
They woke us up again with guns of thunder blaring and pointed to our REAL enemy, public threat number one. The new and REAL, “THEM” We really needed to fear. We targeted all the drugs not under their control and took human lives instead. We rallied and we used this
class because they had told us so, they would protect us all from them.
They Made us all believe we needed them to save us from? They took Cocaine out of pop, Sears & Roebucks stopped selling heroin and coke in all the drug stores and started pushing their poison pills instead. To increase their profits and to end this war that affects us all. They refined their goals with 9-1-1 and made it all out war… on us. We must have missed something and were fooled again.

NOW, We live with cameras on every corner, a snitch in every deal, We turn neighbor against neighbor, Son against Dad. We pay more for our protection and to live yet we do not see or say a thing? Roadblocks, swat teams, guns, dogs, prisons, guards, cops, judges and jails but they are there to keep us safe and happy in our beds.
They took this war serious and “protected the hell out of us all of us. As we stood silent, glad it wasn’t us, this time. They built A.B.C. Agencies to fulfill their new deal goals and We all forgot why the Declaration of Independence or constitution was ever written as it was never taught in grade school. So we would keep going along with the plan and the mass enslaving of us all. Now They live on easy street, the castle on the hill. But They are getting bored so they will
do what comes naturally. They will keep getting meaner and more refined to make some more of them to manage us all and end the threat we caused. As they planned ahead, their plan to conquer the whole world goes on without a hitch. They had us all build our very own cages in hell and no one will see or say a thing? They can rob, dominate, regulate, enslave, and kill us all with our consent. It is simply in their nature and what they naturally do. We all know not to poke a wolf or bear.

Most think, it is too far along to stand up and only seek to die. It is all for our protection and we should be thankful they protect us all yet Still no one will stand or will even say or see a thing? Didn’t we learn anything from history as the cycle repeats again? What next, cigarette swat teams or is it microchip the entire human race with the mark of the beast needed to buy or sell anything? The ones on top plan on killing us all before we wake up to the scam of divide & conquer they need to survive.

. THEY FILL OUR MINDS WITH THE FEARS THEY NEED!

  1. Massive economic and emotional fears of system collapse
  2. Massive incarceration for political crimes.
  3. massive propaganda and incentive to build distrust with your neighbors.
  4. Massive political unrest and distrust were the rule of deliberate indifference and silence rules.
  5. Fascist philosophies of violence and pointing blame and revenge against the target “social disease”
  6. The herding of people into groups for easy targeting.
  7. A building of a cold and indifferent population of no involvement or care for victims.
  8. The making of government dependents for food, health, jobs and housing, they make up the protector class.
  9. Intensified class separations, growing unrest, riots, blaming, and violence.
  10. Massive propaganda of crimes and victims to target hate and Anger to others but them.
  11. They have Built a hateful, ignorant, gullible, hateful, frightened, violent society because that is all they can do.
  12. Ramp-id substance abuse, domestic abuse, alcohol abuse, & personal abuse. mental ills were everyone is medicated with no power to see them. Who need violent crimes and propaganda to galvanize the lines .
  13. The blurring of reality, accountability, law, responsibility, human integrity, morals and decency and the respect for human life, happiness and freedom is gone.
  14. A mental health, a social worker, a cop, judge, lawyer and bureaucrat in every aspect of every life.
  15. The silent acceptance by all is what they need to achieve.

COVID 19 – Evidence Of Global Fraud, POSTED BY: IAIN NOVEMBER 16, 2020

COVID 19 – Evidence Of Global Fraud

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery.  Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

Identification of What Exactly?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.

The WHO’s Laboratory testing guidance states:

“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:

“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

It is not clear that SARS-CoV-2 is a human virus capable of causing widespread illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

Voyage Of Discovery

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”

E Gene target sequence

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

Isolate Nothing

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

“PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

Testing For Nothing

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

  • RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
  • S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
  • E gene (Orf1ab) – small membrane protein used in viral assembly
  • N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and reverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

Conclusive Fraud

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised .

Prince Charles telling us to embrace the Great Reset

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

01/15/21

WHO: No Guarantee COVID Vaccines Will Prevent People From Being Infected

At a virtual press conference held by the World Health Organization officials warned there is no clear evidence COVID-19 vaccines are effective at preventing asymptomatic infection and transmission.

Story at-a-glance:

  • The World Health Organization (WHO) warned there is no guarantee that COVID-19 vaccines will prevent people from being infected with the SARS-CoV-2 virus and transmitting it to other people.
  • Vaccinated persons still need to mask and social distance because they could be able to spread the new coronavirus to others without knowing it, according to WHO and U.S. health officials.
  • As with measles and polio, there is no guarantee of eliminating the SARS-CoV-2 virus through mass vaccination programs.
  • There is a possibility the U.S. government will introduce “COVID-19 vaccine passports” and that some local governments and businesses will make COVID-19 vaccines mandatory, including in schools.
  • Technology companies have been working on creating a digital certificate, which contains personal medical information giving evidence that an individual has been vaccinated and which can be used as a screening tool by employers and businesses.

At a virtual press conference held by the WHO Dec. 28, 2020, officials warned there is no guarantee that COVID-19 vaccines will prevent people from being infected with the SARS-CoV-2 virus and transmitting it to other people.

In a New Year’s Day interview with Newsweek, Dr. Anthony Fauci, director of the National Institute of Allergy and Infectious Diseases, reinforced the WHO’s admission that health officials do not know if COVID-19 vaccines prevent infection or if people can spread the virus to others after getting vaccinated.

According to U.S. and WHO health officials, vaccinated persons still need to mask and social distance because they could be able to spread the new coronavirus to others without knowing it.

Although the U.S. Food and Drug Administration granted Emergency Use Authorization in December 2020 for Pfizer/BioNTech and Moderna to release their experimental mRNA vaccines for use in the U.S., the companies only provided evidence from clinical trials to demonstrate that, compared to unvaccinated trial participants, their vaccines prevented more mild to severe COVID-19 disease symptoms in vaccinated participants.

The companies did not investigate whether the vaccines prevent people from becoming asymptomatically infected with the SARS-CoV-2 virus and/or transmitting it to other people.

COVID-19 vaccines designed to prevent severe disease

According to WHO officials, while it appears the vaccines can prevent clinically symptomatic COVID-19 clinical disease, there is no clear evidence COVID-19 vaccines are effective at preventing asymptomatic infection and transmission. During the press conference, WHO chief scientist and pediatrician Dr. Soumya Swaminathan said:

“We continue to wait for more results from the vaccine trials to really understand whether the vaccines, apart from preventing symptomatic disease and severe disease and deaths, whether they’re also going to reduce infection or prevent people from getting infected with the virus, then from passing it on or transmitting it to other people.

I don’t believe we have the evidence on any of the vaccines to be confident that it’s going to prevent people from actually getting the infection and therefore being able to pass it on.”

Swaminathan said the COVID-19 vaccine was designed to first prevent symptomatic disease, severe disease and deaths. Dr. Mark Ryan, MPH, who is executive director of the WHO Health Emergencies Program, agreed with Swaminathan and added:

“So the first primary objective is to decrease the impact the disease is having on people’s lives and, therefore, that will be a major step forward in bringing the world back to some kind of normal.

The second phase is then looking at how will this vaccine affect transmission. We just don’t know enough yet about length of protection and other things to be absolutely able to predict that, but we should be able to get good control of the virus.”

SARS-CoV-2 eradication via mass vaccination is a ‘moonshot’

Ryan also pointed out that the decision by WHO to try to eradicate the SARS-CoV-2 virus “requires a much higher degree of efficiency and effectiveness in the vaccination program and the other control measures” and that it is likely the new coronavirus will “become another endemic virus, a virus that will remain somewhat of a threat but a very low level threat in the context of an effective vaccination program.”

Ryan cautioned that, like with measles and polio, there is no guarantee of eliminating the SARS-CoV-2 virus through mass vaccination programs. He said:

“The existence of a vaccine even at high efficacy is no guarantee of eliminating or eradicating an infectious disease. That’s a very high bar for us to be able to get over. First, we have to focus on saving lives, getting good control of this epidemic, and then we will deal with the moonshot of potentially being able to eliminate or eradicate this virus.”

Azar says get vaccinated but still mask up

In a Dec.  22, 2020 interview, HHS Secretary Alex Azar told Fox News that the current “consensus” among health officials is that people who get two doses of COVID-19 vaccine should still mask up and practice social distancing. He said:

“We’re still studying some fundamental scientific questions though, such as, once you’ve been vaccinated, do you still need to wear a mask to protect others, could you still be carrying the virus even though you’re protected from it …

“If you’re getting vaccinated right now, still social distance, still wear a mask, but all these [recommendations] have to be data and science-driven, so we’re working to generate the data there so that as we go forward, we’ll be able to advise people on a foundation of data.”

COVID-19 vaccine passports and mandates may be coming

In an interview on CNN in early April 2020 when most states were in some form of a coronavirus lockdown, Fauci told Alyson Camerota, “It’s very likely that there are a large number of people out there that have been infected, have been asymptomatic, and did not know they were infected.”

Eight months later, on New Year’s Day 2021, Fauci told Newsweek that in his role as the new administration’s chief medical adviser, there is a possibility the federal government will eventually introduce “COVID-19 vaccine passports” and that some city, county or state governments and businesses will make COVID-19 vaccines mandatory, including in schools.

“Everything will be on the table,” Fauci declared. A week earlier, Fauci told The New York Times that between 70% and 90% of the U.S. population would need to get COVID-19 vaccinations in order for the country to reach vaccine-acquired herd immunity. He explained why he has continued to shift the “herd immunity” goal post over the past year:

“When polls said only about half of all Americans would take a vaccine, I was saying herd immunity would take 70 to 75 percent. Then, when newer surveys said 60 percent or more would take it, I thought, ‘I can nudge this up a bit,’ so I went to 80, 85 … We really don’t know what the real number is. I think the real range is somewhere between 70 to 90 percent. But, I’m not going to say 90 percent.”

Even as Fauci discussed vaccine passports and mandates in Newsweek, he admitted that proving that COVID-19 vaccines do more than prevent clinical disease but also block infection and transmission has been elusive. He emphasized that persons who get vaccinated still must wear masks:

“We do not know if the vaccines that prevent clinical disease also prevent infection. They very well might, but we have not proven that yet … That’s the reason I keep saying that even though you get vaccinated, we should not eliminate, at all, public health measures like wearing masks because we don’t know yet what the effect [of the vaccine] is on transmissibility.”

Fauci added, “We don’t know what we don’t know.”

Immunity passports: suggested soon after the pandemic began

Government health officials in Israel are getting ready to issue a COVID-19 “green passport” to citizens who have received two COVID-19 shots, which will exempt them from travel restrictions and testing for infection with the SARS-CoV-2 virus or being required to quarantine after exposure to an infected person.

Technology companies have been working on creating a digital certificate, which contains personal medical information giving evidence that an individual has been vaccinated and can be used as a screening tool by employers, businesses and owners or operators of services and public venues, such as airlinestheme parksconcert halls, hotels and other places where people gather in groups with other people.

Immediately after the coronavirus pandemic was declared by the WHO last winter, Silicon Valley businessman Bill Gates began talking about the need for issuing digital certificates proving immunity to the virus and, once a COVID-19 vaccine becomes available, proof of vaccination.

In a comment posted on Reddit in March 2020, Gates said, “Eventually we will have some digital certificates to show who has recovered or been tested recently or when we have a vaccine who has received it.”

That same month in a TED Talk, Gates explained how lockdowns and resulting “economic pain” will prevent people from getting naturally acquired immunity to the SARS-CoV-2 virus and that immunity “certificates” will eventually be required. Gates said:

“Now we don’t want to have a lot of recovered people, you know. To be clear, we’re trying through the shutdown in the United States, to not get to one percent of the population infected. We’re well below that today, but with exponentiation you could get past that three million. I believe we will be able to avoid that with having this economic pain.

“Eventually, what we’ll have to have is certificates of who is a recovered person, who’s a vaccinated person, because you don’t want people moving around the world where you’ll have some countries that won’t have it under control, sadly. You don’t want to completely block off the ability for people to go there and come back and move around.”

In an April 9, 2020, interview on National Public Radio, Gates returned to the message that some “social distancing” measures have to stay in place “until we get a vaccine that almost everybody’s had.” He said:

“What I’m saying, what Dr. Anthony Fauci is saying, what some other experts are saying, there’s a great deal of consistency. We’re not sure yet which activities should be resumed, because until we get a vaccine that almost everybody’s had, the risk of a rebound will be there.”

As of Jan. 3, 2021, the CDC had recorded over 20 million COVID-19 cases and nearly 350,000 related deaths.

Lasting immunity after mild, asymptomatic COVID-19 infection

A study was published Dec. 24, 2020, in Science Immunology by scientists from Queen Mary, University of London, in which they analyzed antibody and T cell responses in 136 London health care workers and reported that there was evidence of protective immunity up to four months after mild or asymptomatic COVID-19.

press release issued by the university stated that mild or asymptomatic SARS-CoV-2 infections represent the largest infected group and noted that researchers found T cell responses tended to be higher in those with the classic, defining symptoms of COVID-19, while asymptomatic infection resulted in a weaker T cell immunity than symptomatic infection, but equivalent neutralizing antibody responses. One of the researchers commented:

“Our study of SARS-CoV-2 infection in healthcare workers from London hospitals reveals that four months after infection, around 90 percent of individuals have antibodies to block the virus. Even more encouragingly, in 66 percent of healthcare workers we see levels of these protective antibodies are high and that this robust antibody response is complemented by T cells which we see reacting to various parts of the virus.

“This is good news. It means that if you have been infected there is a good chance that you will have developed antibodies and T cells that may provide some protection if you encounter the virus again.”

Originally published by Mercola.

The views and opinions expressed in this article are those of the authors and do not necessarily reflect the views of Children’s Health Defense.

The Biden Crime Family


Pres Trump is most admired man in America, according to Gallup Polls – sorry Libtards: “Orange Man Bad” is minority opinion
https://www.marketwatch.com/story/donald-trump-breaks-barack-obamas-record-streak-as-americas-most-admired-man-11609254922?mod=MW_article_top_stories

Ukraine releases Documents showing the Biden Crime Family robbed Ukraine People of Millions of Dollars
Ukraine Press Conference Explicitly Ties Hunter & Joe Biden To Corruption
https://www.zerohedge.com/political/ukraine-press-conference-explicitly-ties-hunter-joe-biden-corruption

kiikolkjkfmgboaa

YouTube Press Release in Ukrainian with English Subtitles:  https://www.youtube.com/watch?v=hKDXVo-OKeQ&feature=emb_logo

New Files Released From Ukraine Reveals Biden, Obama Officials Allegedly
Got 17.5 MILLION Dollars Through Racketeering
https://thehill.com/opinion/campaign/463307-solomon-these-once-secret-memos-cast-doubt-on-joe-bidens-ukraine-story

Get Ukraine Docs on Biden from  https://www.scribd.com/user/259237201/JohnSolomon
https://rightwingtribune.com/2019/10/12/new-files-released/
https://www.foxnews.com/politics/documents-heighten-scrutiny-on-biden-ukraine-dealings-indicate-hunter-may-have-made-millions
https://www.breitbart.com/2020-election/2019/09/26/report-hundreds-of-documents-conflict-with-joe-bidens-account-of-why-ukrainian-prosecutor-was-fired/

Ukrainian Lawmaker Says Joe Biden Took $900k from Burisma While Still in Office, Claims To Have Documents Proving It
https://www.westernjournal.com/ukrainian-lawmaker-says-joe-biden-took-900k-burisma-still-office-claims-documents-proving/

The Biden Family also got massive Bribes from China

——– Forwarded Message ——–Subject:
China wired $$$ to Hunter Biden, Hunter wired some to Joe – Joe Biden will be arrested, not inaugurated
Date:  Mon, 28 Dec 2020 18:18:20 -0800
China wired $$$ to Hunter Biden, then Hunter wired $$$ to Joe – Joe Biden will be arrested, not inaugurated

jecbahoepjackhji
Hunter Biden in 2017 sent ‘best wishes’ from ‘entire Biden family’ to China firm chairman, requested $10M wire
https://www.foxnews.com/politics/hunter-biden-letter-chinese-cefc-chairman-wire-request
BIDEN TAPES REVEAL HUNTER AND JOE GUILTY OF SECRET CHINA DEALS!        https://themarshallreport.wordpress.com/2020/12/11/biden-tapes-reveal-hunter-and-joe-guilty-of-secret-china-deals/
Imposter Joe Biden must be arrested, prosecuted and incarcerated for the good of the Republic
https://www.sgtreport.com/2020/12/imposter-joe-biden-must-be-arrested-prosecuted-and-incarcerated-for-the-good-of-the-republic-2/

How Treasury Dept. tracked overseas cash pocketed by Hunter Biden
https://www.washingtontimes.com/news/2020/oct/4/how-treasury-dept-tracked-overseas-cash-pocketed-b/

Senate investigators: New records ‘confirm’ troubling Biden family links to China and Russia
https://www.washingtonexaminer.com/news/senate-investigators-new-records-confirm-troubling-biden-family-links-to-china-and-russia

The Biden Corruption Scandal Isn’t About Hunter, It’s About Joe
https://thefederalist.com/2020/10/19/the-biden-corruption-scandal-isnt-about-hunter-its-about-joe/

hgchjooijbglanhc

Hunter Biden’s addiction is not the issue. Joe Biden’s addiction is: His addiction to power and money.
And it is the evidence of the former vice president’s corruption, and the national security risk our country would face by electing Biden,
that is the story of the MacBook hard drive, not the salacious, verified photographs and videos of Hunter Biden.
Data and emails on Hunter Biden’s Laptop show everything.

And then Ukraine:

Ukraine releases Documents showing the Biden Crime Family robbed Ukraine People of Millions of Dollars
YouTube Press Release in Ukrainian with English Subtitles:  https://www.youtube.com/watch?v=hKDXVo-OKeQ&feature=emb_logo

New Files Released From Ukraine Reveals Biden, Obama Officials Allegedly
Got 17.5 MILLION Dollars Through Racketeering
https://thehill.com/opinion/campaign/463307-solomon-these-once-secret-memos-cast-doubt-on-joe-bidens-ukraine-story

Get Ukraine Docs on Biden from  https://www.scribd.com/user/259237201/JohnSolomon
https://rightwingtribune.com/2019/10/12/new-files-released/
https://www.foxnews.com/politics/documents-heighten-scrutiny-on-biden-ukraine-dealings-indicate-hunter-may-have-made-millions
https://www.breitbart.com/2020-election/2019/09/26/report-hundreds-of-documents-conflict-with-joe-bidens-account-of-why-ukrainian-prosecutor-was-fired/
Ukrainian Lawmaker Says Joe Biden Took $900k from Burisma While Still in Office, Claims To Have Documents Proving It
https://www.westernjournal.com/ukrainian-lawmaker-says-joe-biden-took-900k-burisma-still-office-claims-documents-proving/


The Biden Family also got massive Bribes from China

hitler

——– Forwarded Message ——–Subject:
PA House finds 200,000 bogus votes
Date:  Mon, 28 Dec 2020 17:26:52 -0800

PA House finds 200,000 bogus votes (next AZ, NV, WI, MI, GA)
https://hereistheevidence.com/election-2020/pa-update-records/
https://twitter.com/russdiamond/status/1343622485946880007
https://www.thegatewaypundit.com/2020/12/breaking-pennsylvania-certified-results-president-found-error-error-twice-size-difference-candidates/

After nearly two months, the state of Pennsylvania is found to have certified votes that are in error.
The Pennsylvania House has just uncovered that the certified results in Pennsylvania for President are in error by more than 200,000 votes.
This is more than twice the difference between President Trump and Joe Biden.

Stop the Steal!   https://stopthesteal.us/
Plot to Steal America Video – 17 minute Video
https://www.facebook.com/DonaldTrump/videos/219439113008326

bpgcngnphpkhekeh

Not just Corruption – actually Treason!  
Media Controls Public Opinion and even Censors the President.
Counterfeit Ballots, hacked Dominion Election-counting Software that weights votes more to Biden.
Shredded Ballots, all for Trump
—————————————————————-
Statement on Election Fraud by President Trump – 14 minute Video

https://www.facebook.com/DonaldTrump/videos/436515744393744
————————————————————————–

Watch Security Camera Videos that show the SAME Ballots stuffed into machines over and over again
https://www.thegatewaypundit.com/2020/12/president-trump-retweets-gateway-pundit-video-showing-poll-workers-stuffing-ballots-tabulators-numerous-times-election-night/
——————————————————————————–
Peter Navarro presents his report on Election Fraud
https://www.facebook.com/watch/?v=1723824047794927
36 page Navarro Report of Election Fraud in 6 States
https://www.thegatewaypundit.com/2020/12/theft-thousand-cuts-assistant-president-trump-peter-navarro-produces-report-fraud-2020-election/
https://phibetaiota.net/wp-content/uploads/2020/12/Navarro-Report-Six-Dimensions-Election-Irregularities.pdf
———————————————————————————
Summary of the Voter Fraud by OAN – 1-1/2 minutes

————————————————————————————–
Stop The Steal – 1 minute Video

https://www.facebook.com/DonaldTrump/videos/238598167675214
—————————————————————————————-
Georgia Poll Worker details the Fraud he saw – 2 minute Video

https://www.facebook.com/DonaldTrump/videos/230560558543713
—————————————————————————————
Fight for Trump – Save America, Save the World – 2 minute Video
https://www.facebook.com/153080620724/videos/2849119275359249

migcfghhfiefehin

How to Steal an Election – 1 minute Video
https://streamable.com/8cdi3o
A powerful video laying out the globalist plot to steal the 2020 presidential election starting with the release of the China Virus
went viral over the weekend after President Trump shared it on Twitter.
Twitter suspended the account of @CJTruth, the user who shared the video shortly after President Trump had retweeted it on Sunday.
https://banned.video/watch?id=5fdfdb96222e2d0828f87784

imcmhhbgkfcgpcmc

Dominion software deleted over 2.7 million votes nationwide, switched over 500,000 from Trump to Biden

https://www.naturalnews.com/2020-11-12-trump-bombshell-dominion-software-deleted-votes-switched-biden.html

ohmepboibgeebcjm

Watch Security Camera Videos that show the SAME Ballots stuffed into machines over and over again
https://www.thegatewaypundit.com/2020/12/president-trump-retweets-gateway-pundit-video-showing-poll-workers-stuffing-ballots-tabulators-numerous-times-election-night/
More on Trump’s WINs in Court and with State Legislatures
Listen to President Trump’s latest 6 minute speech
https://www.facebook.com/DonaldTrump/videos/436515744393744/?t=10

Will TRUMP be the NEXT LINCOLN?? Will TRUMP smash the DEEP STATE COUP??
1) Election Vote FRAUD is proven in many States
36 page Navarro Report of Election Fraud in 6 States
https://www.thegatewaypundit.com/2020/12/theft-thousand-cuts-assistant-president-trump-peter-navarro-produces-report-fraud-2020-election/
https://phibetaiota.net/wp-content/uploads/2020/12/Navarro-Report-Six-Dimensions-Election-Irregularities.pdf
 

6) Lawsuits continue in many States and Supreme Court
7) Some State Legislatures may overturn Fraudulent Election in their State (like PA now)

I can’t be the only one with problems with the added pork!


https://www.zerohedge.com/political/pork-city-here-are-most-ridiculous-pet-projects-900-billion-spending-package

Pork City: Here Are The Most Ridiculous Pet Projects In $900 Billion Stimulus Package

Tyler Durden's Photo
by Tyler Durden
Monday, Dec 21, 2020 – 17:40

As Congress prepares to pass a $900 billion COVID-19 stimulus bill rolled into a consolidated appropriations package – with funding for assistance for households and businesses, along with vaccine distribution and other pandemic-related measures, the bill also includes a ton of pork per usual.

Illustration via WSJ.com

https://www.zerohedge.com/political/pork-city-here-are-most-ridiculous-pet-projects-900-billion-spending-package
Pet Pork Projects in the $900 Billion Stimulus Package:
(What do these Pork Projects have to do with Covid Help???)
($50 Billion? in Ridiculous Pet Projects added to Covid Help Bill )
$453 Million to Ukraine
$10 Million for Gender Programs in Pakistan
$3.3 Billion to Israel
$1.3 Billion to Egypt
$700 Million to Sudan
$130 Million to Nepal
$135 Million to Burma
$85.5 Million to Cambodia
$1.4 Billion for Asia Reassurance
$4 Billion for Navy Weapons
$2 Billion for Space Force
$2 Billion for Air Force Missiles
$208 Million to upgrade Census Bureau computers to prep for 2030
$40 Million for the Kennedy Center
$193 Million for HIV/AIDS workers to buy cars and a museum

IF WE HAD 10 OF YOU WE’D RULE THE WORLD: BIDEN TO STACEY ABRAMS (VIDEO) — ARLIN REPORT……………….walking this path together

Originally posted on Burst Updates: Biden spoke at Georgia’s senate runoff campaign yesterday: “Stacey if we had 10 of you we could rule the whole world. God love ya. If you want to do the bidding of Texas, you should be running in Texas.” The dem goal is to beat GOP candidates Loeffler and Perdue…

IF WE HAD 10 OF YOU WE’D RULE THE WORLD: BIDEN TO STACEY ABRAMS (VIDEO) — ARLIN REPORT……………….walking this path together
%d bloggers like this: