Another False Flag To Add To The List!

The Highwayman's avatarThe Highwayman

You really don’t think that this event in the Suez canal was an ACCIDENT… do you?

They say that it won’t be long before the rest of the world realizes the economic impact from this debacle… but, is it REALLY  a debacle or is it just another globalist-planned crisis like the Covid scam to further fuck with society and bring it to a grinding halt at their feet?  It’s the latter, folks, you can bet the farm on it.

These megalomaniacal bastards know no restraints, their plans for world government have been in the works for thousands of years, a multi-generational scheme to control it ALL.  Up to now, their movements have been relatively slow, but, things are heating up fast.  They know the time is ripe for the take-over, society has never been more compliant than it is, today.  People will believe anything and put up with anything rather…

View original post 377 more words

Massive Lawsuit Announced to Challenge Private Federal Reserve Secrecy

EXCLUSIVE: Massive Lawsuit Announced to Challenge Private Federal Reserve Secrecy

Infowars.com

March 25th 2021, 5:55 pmConstitutional lawyer Robert Barnes announces plan to use FOIA process to force audit the Fed.Image Credit:OLIVIER DOULIERY/AFP via Getty ImagesSHARE

Fund the InfoWar. Donate Now!Keep up to date with our latest:EMAILSign Up NowHave an important tip? Let us know.EMAIL US HERE.

Robert Barnes gives The Alex Jones Show the exclusive breaking news about a new lawsuit to challenge the private Federal Reserve’s secrecy.https://api.banned.video/embed/605cee1bdccdd161300756b6

Visit https://vivabarneslaw.locals.com/ for more information.

Democrats Words, Lead to Mass Shootings

How to Reduce or Eliminate Mass Shootings

Thomas DiLorenzo

About three weeks ago the Demo-Bolsheviks announced that they were starting a new attack on the Second Amendment with a push for more gun-control laws that would further disarm law-abiding citizens (the only ones who would obey such laws).  Then there were two widely-publicized mass shootings in Atlanta and Boulder (unlike the not-so-publicized daily mass shootings in Chicago, Baltimore, Atlanta, and other heavily “gun-controlled” Demo-Bolshevik-run cities).

Obviously, the way to reduce or eliminate mass shootings is to get the Demo-Bolsheviks to stop threatening to destroy the Second Amendment once and for all. It seems like every time they make an announcement like this, sure enough, there is then a mass shooting that (they think) bolsters their case.

Wisconsin Approves Election Invist

Wisconsin State Assembly Approves 2020 Election Investigation March 24, 2021 | Sundance | 368 Comments

The Wisconsin state legislature has passed a resolution authorizing an official investigation into the 2020 election in the badger state.  The resolution allows for evidence gathering and subpoena power for witness depositions.

Via Associated Press – MADISON, Wis. (AP) — The Republican-controlled Wisconsin Assembly passed a resolution Tuesday to authorize an investigation into the 2020 presidential election that President Joe Biden narrowly won in the state.

The resolution, opposed by Democrats, is needed to give the committee authorization if it decides to issue subpoenas to compel testimony and gather documents, said Rep. Joe Sanfelippo. He is vice-chairman of the Assembly elections and campaign committee that would conduct the probe.

The resolution authorizing the investigation passed on a 58-35 party line vote, with all Republicans in support and all Democrats against. It passed after Republicans last month ordered an audit of the election results. (read more)

Trump Rally Wisconsin, November 2, 2020 Posted in 1st Amendment, Big Government, Big Stupid Government, Conspiracy ?, Donald Trump, Election 2020, Joe Biden, media bias, President Trump, Uncategorized

U.S. Health Officials Accuse AstraZeneca of Misrepresenting Efficacy Data

03/23/21•

BIG PHARMA › NEWS

U.S. Health Officials Accuse AstraZeneca of Misrepresenting Efficacy Data

An independent trial review board says AstraZeenca may have included outdated information about its clinical trial results in a press release.By Megan Redshaw

Link copied

In a “highly unusual” statement Tuesday, a U.S. health agency said AstraZeneca may have included “outdated information” in its clinical trial results, which may have led to the vaccine maker providing the public with an incomplete view of its efficacy data.

The statement by the National Institute of Allergy and Infectious Diseases (NIAID) came less than a day after the pharmaceutical company said its vaccine was 79% effective against COVID and 100% effective against severe or critical disease and hospitalization.

“We urge the company to work with the Data and Safety Monitoring Board (DSMB) to review the efficacy data and ensure the most accurate, up-to-date efficacy data be made public as quickly as possible,” the NIAID said.

AstraZeneca immediately responded saying the numbers published Monday were based on a “pre-specified interim analysis with a data cut-off” of Feb. 17. The company promised to “immediately engage with the DSMB to share their primary analysis with the most up-to-date efficacy data” and to issue the results of the primary analysis within 48 hours.

The DSMB is an independent expert group that sees trial data before the pharmaceutical companies, the doctors running the trials or even the U.S. Food and Drug Administration (FDA), according to CNN. It has the authority to advise a company of positive interim findings or to halt a trial over safety concerns, which is what happened to AstraZeneca last September after a study participant developed neurological symptoms.

In an interview with Good Morning America, NIAID Director Dr. Anthony Fauci explained the sequence of events. Fauci said that the DSMB and AstraZeneca reviewed the trial data together before the vaccine maker issued its press release. But when AstraZeneca issued its press release, the DSMB “got concerned and wrote a rather harsh note to them and with a copy to me saying that in fact the data that was in the press release were somewhat outdated and might in fact be misleading a bit and wanted them to straighten it out.”

That’s when NIAID issued its statement advising AstraZeneca that it “better get back with the DSMB to make sure that the correct data gets put into a press release,” Fauci said. Fauci said that DSMB picking up this discrepancy is really “a safeguard.”

In a statement to the Science Media Centre in the UK, Stephen Evans, professor of pharmacoepidemiology at the London School of Hygiene and Tropical Medicine, said that members of the DSMB sometimes disagree with investigators over vaccine trial results, but usually in private. “So this is unprecedented in my opinion,” Evans said.

  • As analysts scrambled to interpret the statement, one scientist claimed the U.S. government stopped just short of accusing AstraZeneca of manipulating its trial data.

“This is a highly unusual statement by the U.S. National Institute of Allergy and Infectious Diseases (NIAID). It comes close to accusing Oxford/AZ of having wilfully misrepresented some results from their recent U.S. vaccine trial,” tweeted Francois Balloux, professor and director of the UCL Genetics Institute.https://platform.twitter.com/embed/Tweet.html?dnt=false&embedId=twitter-widget-0&frame=false&hideCard=false&hideThread=false&id=1374230777601388546&lang=en&origin=https%3A%2F%2Fchildrenshealthdefense.org%2Fdefender%2Fastrazeneca-misrepresenting-efficacy-data%2F&siteScreenName=ChildrensHD&theme=light&widgetsVersion=e1ffbdb%3A1614796141937&width=550px

According to The New York Times, companies sponsoring drug or vaccine trials typically wait for the monitoring board to review analyses and conclude that the study has yielded an answer before they announce trial results.

In recent days, the monitoring board’s analysis of the AstraZeneca trial was delayed several times because the board asked for revised reports from those handling trial data on behalf of the company. The monitoring board ultimately conveyed the results of the study to AstraZeneca in a meeting over the weekend, leading to the company’s press release Monday morning.

Dr. Eric Topol, a clinical trials expert at Scripps Research in San Diego, said it was “highly irregular” to see such a public display of friction between a monitoring board and a study sponsor. “I’ve never seen anything like this,” he told the Times after the institute’s statement was released. “It’s so, so troubling.”

According to Zero Hedge, the AstraZeneca vaccine — which is a linchpin of the World Health Organization’s effort to vaccinate poorer countries via its Bill Gates-approved COVAX initiative — once again finds itself mired in controversy. Notably, in its most recent data, AstraZeneca neglected to include key information, such as  the number of trial participants who developed “severe COVID.” AstraZeneca President Ruud Dobber, during an interview on CNBC’s Squawk Box, said the number was “5,” shortly after the data were released.

“The way they handled their data early on, AstraZeneca basically shot themselves in the foot,” Julian Tang, a virologist at the University of Leicester, said even before the latest issue arose.

AstraZeneca has received criticism over its studies since the first data released in the UK, which purported to show the vaccine was 70% effective, yet failed to account for a manufacturing mistake and didn’t include enough participants over 65 to determine efficacy among older patients, reported ZeroHedge.

European governments like Germany and France responded by initially limiting the jab to patients under the age of 65. In the U.S., officials suspended AstraZeneca’s study in 30,000 Americans for an unusual six weeks last fall, as frustrated regulators sought details about neurological problems reported in Britain.

The latest controversy comes after 20 countries suspended use of AstraZeneca last week based on reports of rare blood clots, some resulting in death, in healthy people who received the vaccine. Although The European Medicines Agency (EMA) found the Oxford-AstraZeneca COVID vaccine “may be associated with very rare cases of blood clots,” it deemed the vaccine “safe and effective” and encouraged countries to use it, The Defender reported.

Two independent research teams in Norway and Germany announced Friday they identified antibodies that provoke immune reactions leading to the type of blood clots experienced by some people who received AstraZeneca’s COVID vaccine. Although many countries resumed their vaccination program with AstraZeneca’s vaccine after the EMA’s preliminary findings, some countries, including France, Denmark, Norway, Sweden and Finland, have not lifted their restrictions on its use, according to The British Medical Journal.

AstraZeneca said it would continue to analyze the new data and prepare to apply in the coming weeks for Emergency Use Authorization (EUA) from the FDA, reported the Times. If approved in the U.S. AstraZeneca would become the fourth available vaccine stateside, joining ModernaPfizer and Johnson & Johnson.

We Get Crumbs… — Freedom Is Just Another Word…

And Federal employees get!!! Americans Will Get $1,400 Once from Dem COVID Relief Bill, Federal Workers Can Get $21,000 Of taxpayers money… “Under the bill as currently drafted, full-time federal employees can take up to 600 hours in paid leave until September 30, up to $35 an hour and $1,400 a week. That’s 15 weeks […]

We Get Crumbs… — Freedom Is Just Another Word…

Government Dependence

27% Of All Household Income In The US Now Comes From The Government

Tyler Durden's Photoby Tyler DurdenFriday, Feb 26, 2021 – 11:45

https://www.zerohedge.com/markets/27-all-household-income-us-now-comes-government

Following today’s release of the latest Personal Income and Spending data, Wall Street was predictably focused on the changes in these two key series, which showed a surge in personal income (to be expected in the month when the $900BN December 2020 stimulus hit), coupled with a far more modest increase in personal spending.

But while the change in the headline data was notable, what was far more remarkable was data showing just how reliant on the US government the population has become.Recommended VideosGoogle Launches Stadia Gaming Platform  

https://imasdk.googleapis.com/js/core/bridge3.444.1_en.html#goog_333981534 Now Playing Google Launches Stadia Gaming Platform Up Next One Punch Man: A Hero Nobody Knows: Street Date Announcement Trailer (PS4) Overwatch 2 – Gameplay Trailer Big carmakers get serious about esports Story of a Gladiator – Launch Trailer Facetime-style Word Game Seeks to Connect Players Paladins – Tiberius, The Weapon’s Master – Cinematic Trailer One Piece: Pirate Warriors 4: Release Date Announcement Trailer (Xbox One)

We are referring, of course, to Personal Current Transfer payments which are essentially government sourced income such as unemployment benefits, welfare checks, and so on. In January, this number was $5.781 trillion annualized, which was not only up by nearly $2 trillion from the $3.8 trillion in December it was also $2 trillion above the pre-Covid trend where transfer receipts were approximately $3.2 trillion.

This means that excluding the $2 trillion annualized surge in govt transfers, personal income excluding government handouts actually declined by $22.3BN from $15.696TN to $15.673TN, hardly a sign of a healthy, reflating economy.

Shown in longer-term context, one can see the creeping impact of government payments, shown in red below.

This, as noted earlier, was due to the latest round of government stimulus checks hitting personal accounts which in turn helped push the savings rate to a whopping 20.5% from 13.4% at the end of 2020.

Stated simply, what all this means is that the government remains responsible for over a quarter of all income, or 26.9 to be precise!

Imagine what that income chart will look like after Biden’s $1400 checks go out?

Putting that number in perspective, in the 1950s and 1960s, transfer payment were around 7%. This number rose in the low teens starting in the mid-1970s (right after the Nixon Shock ended Bretton-Woods and closed the gold window). The number then jumped again after the financial crisis, spiking to the high teens.

And now, the coronavirus has officially sent this number into the mid-20% range, after hitting a record high 31% in April.

And that’s how creeping banana republic socialism comes at you: first slowly, then fast.

So for all those who claim that the Fed is now (and has been for the past decade) subsidizing the 1%, that’s true, but with every passing month, the government is also funding the daily life of an ever greater portion of America’s poorest social segments.

Who ends up paying for both?

Why the middle class of course, where the dollar debasement on one side, and the insane debt accumulation on the other, mean that millions of Americans content to work 9-5, pay their taxes, and generally keep their mouth shut as others are burning everything down and tearing down statues, are now doomed.

The “good” news? As we reported last November, the US middle class won’t have to suffer this pain for much longer, because while the US has one one of the highest median incomes in the entire world, with only three countries boasting a higher income, it is who gets to collect this money that is the major problem, because as the chart also shows, with just a 50% share of the population in middle-income households, the US is now in the same category as such “banana republics” as Turkey, China and, drumroll, Russia.

What is just as stunning: according to the OECD, more than half of the countries in question have a more vibrant middle class than the US.

So the next time someone abuses the popular phrase  “they hate us for our [fill in the blank]”, perhaps it’s time to counter that “they” may not “hate” us at all, but rather are making fun of what has slowly but surely become the world’s biggest banana republic?

And as we concluded last year, “it has not Russia, nor China, nor any other enemy, foreign or domestic, to blame… except for one: the Federal Reserve Bank of the United States.”

Discrimination

Media Silent as Biden Illegally Holds Unaccompanied Migrant Children, Says Border Patrol Union

75,985

Young detainees sleep in a U.S. Customs and Border Protection holding cell in Brownsville, Texas. More than 50,000 unaccompanied migrant kids have been detained in the last eight months, an almost 100 percent increase from the previous fiscal year. (AP File Photo: Eric Gay)
AP File Photo: Eric Gay

BOB PRICE23 Feb 202111,4725:05

The mainstream media is being silent as the Biden administration holds unaccompanied migrant children in Border Patrol custody longer than legally allowed, the head of the Border Patrol union stated. The minors are being held in the same “cages” the media and Democrat politicians loudly criticized the Trump administration for.

National Border Patrol Council President Brandon Judd told Breitbart Texas that as of Monday, Border Patrol officials held more than 800 Unaccompanied Alien Children (UAC) in custody. Despite the legal requirement to release the children to other federal agencies within 72 hours, more than 212 remained in custody longer than the legal limit.

“Today, [White House Press Secretary] Jen Psaski said the Administration could not hold the children in other locations due to the Covid protocols including social distancing,” Judd told Breitbart, “but what she didn’t tell the media was that the children in [Border Patrol’s] custody were being held in conditions that have nearly no way to social distance.”

Psaki’s remarks came in a Tuesday press briefing in response to questions from Fox News White House Correspondent Peter Doocy. Forbes tweeted a video of the exchange.https://platform.twitter.com/embed/Tweet.html?creatorScreenName=BobPriceBBTX&dnt=false&embedId=twitter-widget-0&frame=false&hideCard=false&hideThread=false&id=1364268287656407040&lang=en&origin=https%3A%2F%2Fwww.breitbart.com%2Fborder%2F2021%2F02%2F23%2Fmedia-silent-as-biden-illegally-holds-unaccompanied-migrant-children-says-border-patrol-union%2F&siteScreenName=BreitbartNews&theme=light&widgetsVersion=889aa01%3A1612811843556&width=550px

To be clear, Judd states that the Biden administration is holding unaccompanied minors in Border Patrol custody longer than the law allows in conditions where social distancing cannot be maintained in order to keep social distancing in other federal facilities.

“The hypocrisy from the left and the mainstream media truly shows they care nothing for the children they used as pawns to attack President Trump.”  Judd said.

“Today Jen Psaski said ‘Customs and Border Control’ [not Customs and Border Protection] continue to transfer unaccompanied children to HHS’ Office of Refugee and Resettlement (ORR),” the Border Patrol union leader explained. “She went to great lengths to explain that due to the pandemic and social distancing, ORR only has capacity for a certain number of children.”

“What she didn’t explain is that the children that ORR doesn’t have that capacity to take are left in facilities far worse than those of HHS,” Judd continued. “In fact, they are being held in the same locations they accused the Trump Administration of inhuman acts when they said he was holding ‘kids in cages.’”https://platform.twitter.com/embed/Tweet.html?creatorScreenName=BobPriceBBTX&dnt=false&embedId=twitter-widget-1&frame=false&hideCard=false&hideThread=false&id=1362207461869051906&lang=en&origin=https%3A%2F%2Fwww.breitbart.com%2Fborder%2F2021%2F02%2F23%2Fmedia-silent-as-biden-illegally-holds-unaccompanied-migrant-children-says-border-patrol-union%2F&siteScreenName=BreitbartNews&theme=light&widgetsVersion=889aa01%3A1612811843556&width=550px

U.S. Representative Alexandria Ocasio-Cortez (D-NY) attacked the Biden administration for their expanded policy of opening detention facilities in South Texas, Breitbart’s John Binder reported.

“This is not okay, never has been okay, never will be okay — no matter the administration or party,” the New York congresswoman wrote.

Despite shortages of detention space, the Biden administration, through the U.S> Border Patrol, issued instructions to immediately release migrants in South Texas in order to deal with overcrowding in temporary holding facilities, Breitbart’s Randy Clark reported Tuesday night.

The continuing increase in the apprehension of unaccompanied minors is creating a crisis for the Biden administration along the Southwest border.

The number of Unaccompanied Alien Children illegally crossing the border from Mexico into the U.S. is increasing from month to month, according to reports from U.S. Customs and Border Protection officials. In January 2021, Border Patrol agents apprehended 5,871 unaccompanied minors. This is up from 4,995 in December 2020 and 3,076 in January 2020.

Breitbart Texas reached out to U.S. Customs and Border Protection and Border Patrol for confirmation of the numbers of migrants being held in custody by Border Patrol and how long they are being held. An immediate response from officials was not available by the time of this article’s publication.

Bob Price serves as associate editor and senior news contributor for the Breitbart Texas-Border team. He is an original member of the Breitbart Texas team. Price is a regular panelist on Fox 26 Houston’s Sunday-morning talk show,What’s Your Point? Follow him on Twitter @BobPriceBBTX, Parler @BobPrice, and Facebook.

Border / Cartel ChroniclesMediaPoliticsBrandon JuddJen PsakiNational Border Patrol CouncilPeter Doocyunaccompanied alien childrenUnaccompanied Minors

Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse

https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html#

Bypass censorship by sharing this link:

New

https://www.afinalwarning.com/495900.html Copy URL 30KViews

Image: Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse

(Natural News) America as we know it is over. President Trump is the last president of the United States of America. Fake president Joe Biden wasn’t elected by the people and isn’t a real president, so his fake regime doesn’t count.

Beyond all the politics and cyber warfare and criminal vote fraud carried out by Democrats, what is the real root cause of the fall of America? As I explain in today’s podcast, it really comes down to mass mental illness.

Over half the people in America are mentally poisoned to the point of clinical insanity, and it is these people who attempt to run the government, the fake news outlets, the CDC and public schools, all like some twisted scene out of Idiocracy where even the Secretary of Education is a complete moron.

We’ve already passed the Idiocracy tipping point in America, of course. Fake White House press secretary Jen Psaki is a moron. Fake president Joe Biden has advanced dementia. None of the Democrats in the U.S. Senate can recognize reality anymore, and they function almost entirely as brainwashed bio-puppets who do whatever they’re told. (Which is what NPCs do, of course.) Meanwhile, the people who voted for Biden suffer from the mental illness / cult brainwashing of “progressivism” which is rooted in irrationality, learned hatred and denial of reality.

But what caused all this mass mental illness? It’s not difficult to identify the vectors of the poisoning:

When you put all this together, you realize that a majority of Americans are now cognitively poisoned beyond the point of rationality. Recently, a woman who ran out of hair spray spread Gorilla Glue across her entire head and then couldn’t figure out why the glue wouldn’t wash out in the shower. But that’s not the mass mental illness I’m referring to.

In response to this, people donated $15,000 to her GoFundMe account, and nearly 700,000 followers joined her on Instagram, so the woman has now hired a manager. This is the mass mental illness of the population being demonstrated, where people are attracted to insanity and stupidity and end up supporting it. It really is like a scene ripped right out of Idiocracy.

Here’s a short Brighteon video explaining this fascinating demonstration of total madness and stupidity. It’s too bad Democrats won’t try to use Gorilla Glue as lipstick, so they might glue all their lips shut and stop filling the world with stupidity:

https://www.brighteon.com/embed/88d31489-0456-4e2f-b2e3-c1cdfce48972

In today’s important Situation Update, I reveal why America is over and how the globalists will likely succeed in mass murdering six billion people. It doesn’t look like a process we can stop.

It’s also apparent that the masses are either too stupid or too insane to have any idea what’s happening to them. The Bill Gates effort to mass murder six billion people won’t be difficult for globalists to achieve. Do you really think “Gorilla Glue girl” has any clue that the global depopulation agenda is targeting people like her, whom globalists label “useless eaters?”

Meanwhile, Big Tech censors intelligent people like Sherri Tenpenny or Dr. Joseph Mercola, while promoting the content of idiots who use industrial glue as a hair gel. What’s next? Will she use Gorilla Glue as a food thickener in her macaroni and cheese, and then wonder why she has a stomach ache?

Yet her story isn’t unusual anymore. People are insane everywhere, and that includes US senators, so-called “journalists” and even the “authorities” at the FDA or CDC.

We are no longer living in a world ruled by rationality, morality and clear thinking. The world has collapsed into insanity, immorality and demonism.

This is why America as we know it is over. The genocidal globalists will “win” in their effort to slaughter billions. But after the coming collapse and mass genocide, there will be a “next society” for the survivors, most of whom will be preppers and anti-vaxxers because that’s who is prepared to survive the global culling.

We must all prepare to survive the mass culling and then contribute to the society that emerges on the other side.

Also, there will be no more traffic jams or difficulty finding parking, just fyi.

Brighteon.com/230c068b-2e3b-44e4-9f4f-6f797a1d3b46

https://www.brighteon.com/embed/230c068b-2e3b-44e4-9f4f-6f797a1d3b46

Hear each day’s new podcast at:

https://www.brighteon.com/channels/hrreportPrevious :Natural News launches TOR browser (.onion) website to bring natural health and nutrition knowledge to the dark webNext : Situation Update, Feb. 11th – Environmental groups call out Bill Gates for insanely dangerous global terraforming scheme 30KViews

Receive Our Free Email Newsletter

Get independent news alerts on natural cures, food lab tests, cannabis medicine, science, robotics, drones, privacy and more. https://www.naturalnews.com/Include-ReaderRegistration-2019-Subscribe-Form-UnderArticle.html

More news on brain function

Reducing your sugar intake will help improve your sleep quality and food choicesStudy: Walking slowly may be a sign of “accelerated aging” and that you’re more likely to get sick later in lifeHere’s how you can boost your dopamine levels naturallySituation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapseStudy: Trans fats linked to poor brain health and greater risk of dementia and Alzheimer’sA diet high in trans fats linked to a significantly higher risk of dementia among the elderlyCan abdominal pain affect brain function?Musk mallow seeds can protect the brain against degeneration caused by fluoride toxicityCompounds from two Nigerian vegetables found to inhibit enzymes implicated in neurodegenerative diseasesStudy explains how a chemical from Japanese cornel may help treat Alzheimer’s disease

About the author: Mike Adams (aka the “Health Ranger“) is a best selling author (#1 best selling science book on Amazon.com called “Food Forensics“), an environmental scientist, a patent holder for a cesium radioactive isotope elimination invention, a multiple award winner for outstanding journalism, a science news publisher and influential commentator on topics ranging from science and medicine to culture and politics. Follow his videos, podcasts, websites and science projects at the links below.

Mike Adams serves as the founding editor of NaturalNews.com and the lab science director of an internationally accredited (ISO 17025) analytical laboratory known as CWC Labs. There, he was awarded a Certificate of Excellence for achieving extremely high accuracy in the analysis of toxic elements in unknown water samples using ICP-MS instrumentation. Adams is also highly proficient in running liquid chromatography, ion chromatography and mass spectrometry time-of-flight analytical instrumentation. He has also achieved numerous laboratory breakthroughs in the programming of automated liquid handling robots for sample preparation and external standards prep.

The U.S. patent office has awarded Mike Adams patent NO. US 9526751 B2 for the invention of “Cesium Eliminator,” a lifesaving invention that removes up to 95% of radioactive cesium from the human digestive tract. Adams has pledged to donate full patent licensing rights to any state or national government that needs to manufacture the product to save human lives in the aftermath of a nuclear accident, disaster, act of war or act of terrorism. He has also stockpiled 10,000 kg of raw material to manufacture Cesium Eliminator in a Texas warehouse, and plans to donate the finished product to help save lives in Texas when the next nuclear event occurs. No independent scientist in the world has done more research on the removal of radioactive elements from the human digestive tract.

Adams is a person of color whose ancestors include Africans and American Indians. He is of Native American heritage, which he credits as inspiring his “Health Ranger” passion for protecting life and nature against the destruction caused by chemicals, heavy metals and other forms of pollution.

Adams is the author of the world’s first book that published ICP-MS heavy metals analysis results for foods, dietary supplements, pet food, spices and fast food. The book is entitled Food Forensics and is published by BenBella Books.

In his laboratory research, Adams has made numerous food safety breakthroughs such as revealing rice protein products imported from Asia to be contaminated with toxic heavy metals like lead, cadmium and tungsten. Adams was the first food science researcher to document high levels of tungsten in superfoods. He also discovered over 11 ppm lead in imported mangosteen powder, and led an industry-wide voluntary agreement to limit heavy metals in rice protein products.

In addition to his lab work, Adams is also the (non-paid) executive director of the non-profit Consumer Wellness Center (CWC), an organization that redirects 100% of its donations receipts to grant programs that teach children and women how to grow their own food or vastly improve their nutrition. Through the non-profit CWC, Adams also launched Nutrition Rescue, a program that donates essential vitamins to people in need. Click here to see some of the CWC success stories.

With a background in science and software technology, Adams is the original founder of the email newsletter technology company known as Arial Software. Using his technical experience combined with his love for natural health, Adams developed and deployed the content management system currently driving NaturalNews.com. He also engineered the high-level statistical algorithms that power SCIENCE.naturalnews.com, a massive research resource featuring over 10 million scientific studies.

Adams is well known for his incredibly popular consumer activism video blowing the lid on fake blueberries used throughout the food supply. He has also exposed “strange fibers” found in Chicken McNuggets, fake academic credentials of so-called health “gurus,” dangerous “detox” products imported as battery acid and sold for oral consumption, fake acai berry scams, the California raw milk raids, the vaccine research fraud revealed by industry whistleblowers and many other topics.

Adams has also helped defend the rights of home gardeners and protect the medical freedom rights of parents. Adams is widely recognized to have made a remarkable global impact on issues like GMOs, vaccines, nutrition therapies, human consciousness.

In addition to his activism, Adams is an accomplished musician who has released over fifteen popular songs covering a variety of activism topics.

Click here to read a more detailed bio on Mike Adams, the Health Ranger, at HealthRanger.com.

Find more science, news, commentary and inventions from the Health Ranger at:

Brighteon.com:
Brighteon.com/channel/hrreport

Diaspora: (uncensored social network)
Share.NaturalNews.com

GAB:
GAB.com/healthranger

Podcasts:
HealthRangerReport.com

Online store:
HealthRangerStore.com

#1 Bestselling Science Book Food Forensics:
FoodForensics.com

iTunes:
itunes.apple.com/us/podcast/the-health-ranger-report/id1063165791

SoundCloud:
Soundcloud.com/healthranger

Health Ranger’s science lab
CWClabs.com

Health Ranger bio
HealthRanger.com
TruthWiki.org

Search engine:
Webseed.com

Disqus

https://disqus.com/embed/comments/?base=default&f=naturalnews&t_i=nn%3A81615&t_u=https%3A%2F%2Fwww.naturalnews.com%2F2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html&t_d=Situation%20Update%2C%20Feb.%2010th%20%E2%80%93%20How%20America%20ends%3A%20Mass%20mental%20poisoning%20triggers%20tipping%20point%20of%20collapse&t_t=Situation%20Update%2C%20Feb.%2010th%20%E2%80%93%20How%20America%20ends%3A%20Mass%20mental%20poisoning%20triggers%20tipping%20point%20of%20collapse&s_o=default#version=4ce792797f4c10a96525509c741bcf5f

Take Action: Support Natural News by linking to this article from your website

Permalink to this article:
https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html

Embed article link: (copy HTML code below):
<a href=”https://www.naturalnews.com/2021-02-10-situation-update-feb-10th-how-america-ends-mass-mental-poisoning.html”>Situation Update, Feb. 10th – How America ends: Mass mental poisoning triggers tipping point of collapse</a>

Reprinting this article:

Non-commercial use OK, cite NaturalNews.com with clickable link.

Follow Natural News on Diaspora, AllSocial, USA.Life, Parler, MeWe, and GAB Most Viewed Articles Today Week Month Year

Reference Information

Science.NaturalNews.com
Conduct powerful scientific research in mere seconds for your book, blog, website article or news report.

NaturalPedia.com
A free online encyclopedia of natural health knowledge from the industry’s top authors and writers.

HealingFoodReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of foods.

HerbReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of herbs.

SupplementReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of supplements.

NutrientReference.com
A free public service to promote health freedom and empower consumers with information about the healing power of nutrients.

HonestFoodGuide.org
This free to download food guide offers genuine nutritional information, not watered-down information designed to boost the sale of milk, beef and grains.

Advertise with NaturalNews… Natural News Wire (Sponsored Content)

Advertise with NaturalNews…

Science.News
Science News & Studies

Medicine.News
Medicine News and Information

Food.News
Food News & Studies

Health.News
Health News & Studies

Herbs.News
Herbs News & Information

Pollution.News
Pollution News & Studies

Cancer.News
Cancer News & Studies

Climate.News
Climate News & Studies

Survival.News
Survival News & Information

Gear.News
Gear News & Information

Glitch.News
News covering technology, stocks, hackers, and more Read Archived NaturalNews StoriesNaturalNews.com

Natural News Toolbar
Privacy Policy
Terms of Use
About Us
Contact Us/Feedback
Write for Natural News
Media Information
Advertise Information Follow Us

Email Newsletter
Brighteon.Social
MeWe
GAB
Diaspora
USA.Life
Parler
RSS

Apple iOS app
Android app on Google Play
eTrust Pro Certified

This site is part of the Natural News Network © 2019 All Rights Reserved. Privacy | Terms All content posted on this site is commentary or opinion and is protected under Free Speech. Truth Publishing International, LTD. is not responsible for content written by contributing authors. The information on this site is provided for educational and entertainment purposes only. It is not intended as a substitute for professional advice of any kind. Truth Publishing assumes no responsibility for the use or misuse of this material. Your use of this website indicates your agreement to these terms and those published here. All trademarks, registered trademarks and servicemarks mentioned on this site are the property of their respective owners. Get the world’s best natural health newsletter delivered straight to your inbox.

x

By con

Watch – Doctor Admits Masks Don’t Work: “All Viruses Can Get Through”

by Adan Salazar February 1st 2021, 1:06 pm ‘I wear a mask so people don’t think I don’t care about them, but I don’t wear a mask because they work.’Image Credit:TwitterShareFund the InfoWar. Donate Now!Keep up to date with our latest:EmailSign Up NowHave an important tip? Let us know.Email us here.

A medical doctor’s lecture explaining face masks aren’t effective at blocking viruses has gone viral.

In the message, a member of America’s Frontline Doctors, Dr. Richard Urso, admits masks block little if any microscopic virus particles, contrary to what mainline health experts have been telling the public.

https://platform.twitter.com/embed/Tweet.html?dnt=true&embedId=twitter-widget-1&frame=false&hideCard=false&hideThread=false&id=1355276143159517184&lang=en&origin=https%3A%2F%2Fwww.infowars.com%2Fposts%2Fwatch-doctor-admits-masks-dont-work-all-viruses-can-get-through%2F&theme=light&widgetsVersion=889aa01%3A1612811843556&width=500px

“We know what works — these don’t work against viruses. Regular masks don’t work. That’s simply what it is,” Urso explains.

“It has nothing to do with Covid. Covid doesn’t even factor into the equation, because for years we’ve been looking at these issues.”

The Texas-based ophthalmologist goes on to explain there are more protective methods which would be more effective, but the N-95 masks recommended to the public still allow virus particles to pass.

“So, they have these spacesuits, they’re called ‘PAPRs,’ they’re incredibly effective, they filter viruses down to .01. Basically we have materials like N-99, N-100, but N-95… only five percent of airborne particles can get through, but all viruses can get through period.”

“Now do they get through? No, it’s just like a chainlink fence. When you throw sand at a chainlink fence not all the sand gets through.”

“So, I think the best example I can say is the reason we wear masks and the reason I wear a mask is because the fear is so massive in this country. I wear a mask so people don’t think I don’t care about them, but I don’t wear a mask because they work.”

Dr. Urso’s message is spreading as NIAID Director Anthony Fauci has once again flip-flopped on masks, at first claiming last week that it was “common sense” to wear two, or even up to three masks. Over the weekend, however, Dr. Fauci claimed there was “no data” to indicate that wearing two masks “would make a difference.” https://platform.twitter.com/embed/Tweet.html?dnt=true&embedId=twitter-widget-2&frame=false&hideCard=false&hideThread=false&id=1355991619225448450&lang=en&origin=https%3A%2F%2Fwww.infowars.com%2Fposts%2Fwatch-doctor-admits-masks-dont-work-all-viruses-can-get-through%2F&theme=light&widgetsVersion=889aa01%3A1612811843556&width=500px


Follow the author on Gab: https://gab.ai/adansalazar
On Twitter: https://platform.twitter.com/widgets/follow_button.6e189c4f2b6d88c453045806323cdcf3.en.html#dnt=true&id=twitter-widget-0&lang=en&screen_name=AdanSalazarWins&show_count=false&show_screen_name=true&size=m&time=1613023157347
On Parler: https://parler.com/profile/adansalazar/
On Facebook: https://www.facebook.com/adan.salazar.735
On Minds: https://www.minds.com/adan_infowars https://api.banned.video/embed/60176d089942cd18bc5c2190

BOMBSHELL: MAJOR GOVERNMENTS SAY COVID-19 VACCINE A FRAUD

Read and you decide what is real

writing from an Ed Curtis in North Dakota. His website is https://thefax.webs.com/ – previous ones were lost, according to him

GODS 10 COMMANDMENTS

  1. I am the LORD your God: you shall not have strange Gods
    before me.
  2. You shall not take the name of the LORD your God in vain.
  3. Remember to keep holy the LORD’S Day.
  4. Honor your father and your mother.
  5. You shall not kill.
  6. You shall not commit adultery.
  7. You shall not steal.
  8. You shall not bear false witness against your neighbor.
  9. You shall not covet your neighbor’s wife.
  10. You shall not covet your neighbor’s goods.
    First they came for the kids, The dim druggies, and the handicap and I
    kept quiet,

Then they came for the Jews and I wasn’t a Jew so I remained silent.
Then they came for the Gypsies, criminals, and inferior races, and it was best to remain quiet so I did. When they came for the Catholics, I was too afraid to say anything and didn’t, I could only pray. Then They came for me and there was no one left to protect me from them. Nazi Germany 1932

First we rounded up the Indians and rallied around the troops and the taking of the lands for a few beads and bottles, we took all the land as we all agreed, they were savages, they didn’t deserve it and it all was ours to take.
We gave out diseased blankets, mass starvation s, war and winter marches to all of “THEM “. We took the lands and saved us all from “savages”. For the good of us all but them. We made heroes of those who did the dirty work and we fed and paid them well and off to sleep we went, We were all safe once again.
Then again we were woken to rally up the troops to save us all for THEM, The ones who needed slaves to work the fields Was the enemy of man. We came to free the slaves. Until we took the step forward and invented better machinery or was it until the secrets of slavery became un-cool, too easy to see? It was time to advance the plan, and a new game plan was hatched as our leaders became more educated and refined. Our rulers learned to hide from us in plain site and play us all like fools to support all of them. We advanced our thinking a little and made it ineffective, so they took a step back until we went to sleep again. In the two-step dance, they always play with your life you were never trained to see. We could not argue, We all were in the wrong, letting some keep slaves. Again, a new game plan was born, it took a Civil war to free all of THE people who we had let become enslaved to Work in the fields. Somehow They tricked us and took us ALL in instead. With contracts of forgery and of fraud, and the new deal was off and running. We all became the slaves in their plan and ensured their class would thrive until they reached the grave. Next, they came for the drunks in the days of probation. They found gold mines and power
with new ways to make a buck in a war with all of US. They promoted all the terrible crimes caused by all THEM drunks! The making of crime and criminals plan really moved ahead! But the people were not quite so asleep as yet and it didn’t last very long, 3 steps forward then one back, the safe way to conquer the world. Many were killed but not us this time so we went back to bed. They slowed the game down, We were told “Don’t worry about a thing” and they quietly planned ahead.
They woke us up again with guns of thunder blaring and pointed to our REAL enemy, public threat number one. The new and REAL, “THEM” We really needed to fear. We targeted all the drugs not under their control and took human lives instead. We rallied and we used this
class because they had told us so, they would protect us all from them.
They Made us all believe we needed them to save us from? They took Cocaine out of pop, Sears & Roebucks stopped selling heroin and coke in all the drug stores and started pushing their poison pills instead. To increase their profits and to end this war that affects us all. They refined their goals with 9-1-1 and made it all out war… on us. We must have missed something and were fooled again.

NOW, We live with cameras on every corner, a snitch in every deal, We turn neighbor against neighbor, Son against Dad. We pay more for our protection and to live yet we do not see or say a thing? Roadblocks, swat teams, guns, dogs, prisons, guards, cops, judges and jails but they are there to keep us safe and happy in our beds.
They took this war serious and “protected the hell out of us all of us. As we stood silent, glad it wasn’t us, this time. They built A.B.C. Agencies to fulfill their new deal goals and We all forgot why the Declaration of Independence or constitution was ever written as it was never taught in grade school. So we would keep going along with the plan and the mass enslaving of us all. Now They live on easy street, the castle on the hill. But They are getting bored so they will
do what comes naturally. They will keep getting meaner and more refined to make some more of them to manage us all and end the threat we caused. As they planned ahead, their plan to conquer the whole world goes on without a hitch. They had us all build our very own cages in hell and no one will see or say a thing? They can rob, dominate, regulate, enslave, and kill us all with our consent. It is simply in their nature and what they naturally do. We all know not to poke a wolf or bear.

Most think, it is too far along to stand up and only seek to die. It is all for our protection and we should be thankful they protect us all yet Still no one will stand or will even say or see a thing? Didn’t we learn anything from history as the cycle repeats again? What next, cigarette swat teams or is it microchip the entire human race with the mark of the beast needed to buy or sell anything? The ones on top plan on killing us all before we wake up to the scam of divide & conquer they need to survive.

. THEY FILL OUR MINDS WITH THE FEARS THEY NEED!

  1. Massive economic and emotional fears of system collapse
  2. Massive incarceration for political crimes.
  3. massive propaganda and incentive to build distrust with your neighbors.
  4. Massive political unrest and distrust were the rule of deliberate indifference and silence rules.
  5. Fascist philosophies of violence and pointing blame and revenge against the target “social disease”
  6. The herding of people into groups for easy targeting.
  7. A building of a cold and indifferent population of no involvement or care for victims.
  8. The making of government dependents for food, health, jobs and housing, they make up the protector class.
  9. Intensified class separations, growing unrest, riots, blaming, and violence.
  10. Massive propaganda of crimes and victims to target hate and Anger to others but them.
  11. They have Built a hateful, ignorant, gullible, hateful, frightened, violent society because that is all they can do.
  12. Ramp-id substance abuse, domestic abuse, alcohol abuse, & personal abuse. mental ills were everyone is medicated with no power to see them. Who need violent crimes and propaganda to galvanize the lines .
  13. The blurring of reality, accountability, law, responsibility, human integrity, morals and decency and the respect for human life, happiness and freedom is gone.
  14. A mental health, a social worker, a cop, judge, lawyer and bureaucrat in every aspect of every life.
  15. The silent acceptance by all is what they need to achieve.

COVID 19 – Evidence Of Global Fraud, POSTED BY: IAIN NOVEMBER 16, 2020

COVID 19 – Evidence Of Global Fraud

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery.  Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

Identification of What Exactly?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.

The WHO’s Laboratory testing guidance states:

“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:

“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

It is not clear that SARS-CoV-2 is a human virus capable of causing widespread illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

Voyage Of Discovery

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”

E Gene target sequence

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

Isolate Nothing

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

“PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

Testing For Nothing

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

  • RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
  • S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
  • E gene (Orf1ab) – small membrane protein used in viral assembly
  • N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and reverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

Conclusive Fraud

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised .

Prince Charles telling us to embrace the Great Reset

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

01/15/21

WHO: No Guarantee COVID Vaccines Will Prevent People From Being Infected

At a virtual press conference held by the World Health Organization officials warned there is no clear evidence COVID-19 vaccines are effective at preventing asymptomatic infection and transmission.

Story at-a-glance:

  • The World Health Organization (WHO) warned there is no guarantee that COVID-19 vaccines will prevent people from being infected with the SARS-CoV-2 virus and transmitting it to other people.
  • Vaccinated persons still need to mask and social distance because they could be able to spread the new coronavirus to others without knowing it, according to WHO and U.S. health officials.
  • As with measles and polio, there is no guarantee of eliminating the SARS-CoV-2 virus through mass vaccination programs.
  • There is a possibility the U.S. government will introduce “COVID-19 vaccine passports” and that some local governments and businesses will make COVID-19 vaccines mandatory, including in schools.
  • Technology companies have been working on creating a digital certificate, which contains personal medical information giving evidence that an individual has been vaccinated and which can be used as a screening tool by employers and businesses.

At a virtual press conference held by the WHO Dec. 28, 2020, officials warned there is no guarantee that COVID-19 vaccines will prevent people from being infected with the SARS-CoV-2 virus and transmitting it to other people.

In a New Year’s Day interview with Newsweek, Dr. Anthony Fauci, director of the National Institute of Allergy and Infectious Diseases, reinforced the WHO’s admission that health officials do not know if COVID-19 vaccines prevent infection or if people can spread the virus to others after getting vaccinated.

According to U.S. and WHO health officials, vaccinated persons still need to mask and social distance because they could be able to spread the new coronavirus to others without knowing it.

Although the U.S. Food and Drug Administration granted Emergency Use Authorization in December 2020 for Pfizer/BioNTech and Moderna to release their experimental mRNA vaccines for use in the U.S., the companies only provided evidence from clinical trials to demonstrate that, compared to unvaccinated trial participants, their vaccines prevented more mild to severe COVID-19 disease symptoms in vaccinated participants.

The companies did not investigate whether the vaccines prevent people from becoming asymptomatically infected with the SARS-CoV-2 virus and/or transmitting it to other people.

COVID-19 vaccines designed to prevent severe disease

According to WHO officials, while it appears the vaccines can prevent clinically symptomatic COVID-19 clinical disease, there is no clear evidence COVID-19 vaccines are effective at preventing asymptomatic infection and transmission. During the press conference, WHO chief scientist and pediatrician Dr. Soumya Swaminathan said:

“We continue to wait for more results from the vaccine trials to really understand whether the vaccines, apart from preventing symptomatic disease and severe disease and deaths, whether they’re also going to reduce infection or prevent people from getting infected with the virus, then from passing it on or transmitting it to other people.

I don’t believe we have the evidence on any of the vaccines to be confident that it’s going to prevent people from actually getting the infection and therefore being able to pass it on.”

Swaminathan said the COVID-19 vaccine was designed to first prevent symptomatic disease, severe disease and deaths. Dr. Mark Ryan, MPH, who is executive director of the WHO Health Emergencies Program, agreed with Swaminathan and added:

“So the first primary objective is to decrease the impact the disease is having on people’s lives and, therefore, that will be a major step forward in bringing the world back to some kind of normal.

The second phase is then looking at how will this vaccine affect transmission. We just don’t know enough yet about length of protection and other things to be absolutely able to predict that, but we should be able to get good control of the virus.”

SARS-CoV-2 eradication via mass vaccination is a ‘moonshot’

Ryan also pointed out that the decision by WHO to try to eradicate the SARS-CoV-2 virus “requires a much higher degree of efficiency and effectiveness in the vaccination program and the other control measures” and that it is likely the new coronavirus will “become another endemic virus, a virus that will remain somewhat of a threat but a very low level threat in the context of an effective vaccination program.”

Ryan cautioned that, like with measles and polio, there is no guarantee of eliminating the SARS-CoV-2 virus through mass vaccination programs. He said:

“The existence of a vaccine even at high efficacy is no guarantee of eliminating or eradicating an infectious disease. That’s a very high bar for us to be able to get over. First, we have to focus on saving lives, getting good control of this epidemic, and then we will deal with the moonshot of potentially being able to eliminate or eradicate this virus.”

Azar says get vaccinated but still mask up

In a Dec.  22, 2020 interview, HHS Secretary Alex Azar told Fox News that the current “consensus” among health officials is that people who get two doses of COVID-19 vaccine should still mask up and practice social distancing. He said:

“We’re still studying some fundamental scientific questions though, such as, once you’ve been vaccinated, do you still need to wear a mask to protect others, could you still be carrying the virus even though you’re protected from it …

“If you’re getting vaccinated right now, still social distance, still wear a mask, but all these [recommendations] have to be data and science-driven, so we’re working to generate the data there so that as we go forward, we’ll be able to advise people on a foundation of data.”

COVID-19 vaccine passports and mandates may be coming

In an interview on CNN in early April 2020 when most states were in some form of a coronavirus lockdown, Fauci told Alyson Camerota, “It’s very likely that there are a large number of people out there that have been infected, have been asymptomatic, and did not know they were infected.”

Eight months later, on New Year’s Day 2021, Fauci told Newsweek that in his role as the new administration’s chief medical adviser, there is a possibility the federal government will eventually introduce “COVID-19 vaccine passports” and that some city, county or state governments and businesses will make COVID-19 vaccines mandatory, including in schools.

“Everything will be on the table,” Fauci declared. A week earlier, Fauci told The New York Times that between 70% and 90% of the U.S. population would need to get COVID-19 vaccinations in order for the country to reach vaccine-acquired herd immunity. He explained why he has continued to shift the “herd immunity” goal post over the past year:

“When polls said only about half of all Americans would take a vaccine, I was saying herd immunity would take 70 to 75 percent. Then, when newer surveys said 60 percent or more would take it, I thought, ‘I can nudge this up a bit,’ so I went to 80, 85 … We really don’t know what the real number is. I think the real range is somewhere between 70 to 90 percent. But, I’m not going to say 90 percent.”

Even as Fauci discussed vaccine passports and mandates in Newsweek, he admitted that proving that COVID-19 vaccines do more than prevent clinical disease but also block infection and transmission has been elusive. He emphasized that persons who get vaccinated still must wear masks:

“We do not know if the vaccines that prevent clinical disease also prevent infection. They very well might, but we have not proven that yet … That’s the reason I keep saying that even though you get vaccinated, we should not eliminate, at all, public health measures like wearing masks because we don’t know yet what the effect [of the vaccine] is on transmissibility.”

Fauci added, “We don’t know what we don’t know.”

Immunity passports: suggested soon after the pandemic began

Government health officials in Israel are getting ready to issue a COVID-19 “green passport” to citizens who have received two COVID-19 shots, which will exempt them from travel restrictions and testing for infection with the SARS-CoV-2 virus or being required to quarantine after exposure to an infected person.

Technology companies have been working on creating a digital certificate, which contains personal medical information giving evidence that an individual has been vaccinated and can be used as a screening tool by employers, businesses and owners or operators of services and public venues, such as airlinestheme parksconcert halls, hotels and other places where people gather in groups with other people.

Immediately after the coronavirus pandemic was declared by the WHO last winter, Silicon Valley businessman Bill Gates began talking about the need for issuing digital certificates proving immunity to the virus and, once a COVID-19 vaccine becomes available, proof of vaccination.

In a comment posted on Reddit in March 2020, Gates said, “Eventually we will have some digital certificates to show who has recovered or been tested recently or when we have a vaccine who has received it.”

That same month in a TED Talk, Gates explained how lockdowns and resulting “economic pain” will prevent people from getting naturally acquired immunity to the SARS-CoV-2 virus and that immunity “certificates” will eventually be required. Gates said:

“Now we don’t want to have a lot of recovered people, you know. To be clear, we’re trying through the shutdown in the United States, to not get to one percent of the population infected. We’re well below that today, but with exponentiation you could get past that three million. I believe we will be able to avoid that with having this economic pain.

“Eventually, what we’ll have to have is certificates of who is a recovered person, who’s a vaccinated person, because you don’t want people moving around the world where you’ll have some countries that won’t have it under control, sadly. You don’t want to completely block off the ability for people to go there and come back and move around.”

In an April 9, 2020, interview on National Public Radio, Gates returned to the message that some “social distancing” measures have to stay in place “until we get a vaccine that almost everybody’s had.” He said:

“What I’m saying, what Dr. Anthony Fauci is saying, what some other experts are saying, there’s a great deal of consistency. We’re not sure yet which activities should be resumed, because until we get a vaccine that almost everybody’s had, the risk of a rebound will be there.”

As of Jan. 3, 2021, the CDC had recorded over 20 million COVID-19 cases and nearly 350,000 related deaths.

Lasting immunity after mild, asymptomatic COVID-19 infection

A study was published Dec. 24, 2020, in Science Immunology by scientists from Queen Mary, University of London, in which they analyzed antibody and T cell responses in 136 London health care workers and reported that there was evidence of protective immunity up to four months after mild or asymptomatic COVID-19.

press release issued by the university stated that mild or asymptomatic SARS-CoV-2 infections represent the largest infected group and noted that researchers found T cell responses tended to be higher in those with the classic, defining symptoms of COVID-19, while asymptomatic infection resulted in a weaker T cell immunity than symptomatic infection, but equivalent neutralizing antibody responses. One of the researchers commented:

“Our study of SARS-CoV-2 infection in healthcare workers from London hospitals reveals that four months after infection, around 90 percent of individuals have antibodies to block the virus. Even more encouragingly, in 66 percent of healthcare workers we see levels of these protective antibodies are high and that this robust antibody response is complemented by T cells which we see reacting to various parts of the virus.

“This is good news. It means that if you have been infected there is a good chance that you will have developed antibodies and T cells that may provide some protection if you encounter the virus again.”

Originally published by Mercola.

The views and opinions expressed in this article are those of the authors and do not necessarily reflect the views of Children’s Health Defense.

The Biden Crime Family


Pres Trump is most admired man in America, according to Gallup Polls – sorry Libtards: “Orange Man Bad” is minority opinion
https://www.marketwatch.com/story/donald-trump-breaks-barack-obamas-record-streak-as-americas-most-admired-man-11609254922?mod=MW_article_top_stories

Ukraine releases Documents showing the Biden Crime Family robbed Ukraine People of Millions of Dollars
Ukraine Press Conference Explicitly Ties Hunter & Joe Biden To Corruption
https://www.zerohedge.com/political/ukraine-press-conference-explicitly-ties-hunter-joe-biden-corruption

kiikolkjkfmgboaa

YouTube Press Release in Ukrainian with English Subtitles:  https://www.youtube.com/watch?v=hKDXVo-OKeQ&feature=emb_logo

New Files Released From Ukraine Reveals Biden, Obama Officials Allegedly
Got 17.5 MILLION Dollars Through Racketeering
https://thehill.com/opinion/campaign/463307-solomon-these-once-secret-memos-cast-doubt-on-joe-bidens-ukraine-story

Get Ukraine Docs on Biden from  https://www.scribd.com/user/259237201/JohnSolomon
https://rightwingtribune.com/2019/10/12/new-files-released/
https://www.foxnews.com/politics/documents-heighten-scrutiny-on-biden-ukraine-dealings-indicate-hunter-may-have-made-millions
https://www.breitbart.com/2020-election/2019/09/26/report-hundreds-of-documents-conflict-with-joe-bidens-account-of-why-ukrainian-prosecutor-was-fired/

Ukrainian Lawmaker Says Joe Biden Took $900k from Burisma While Still in Office, Claims To Have Documents Proving It
https://www.westernjournal.com/ukrainian-lawmaker-says-joe-biden-took-900k-burisma-still-office-claims-documents-proving/

The Biden Family also got massive Bribes from China

——– Forwarded Message ——–Subject:
China wired $$$ to Hunter Biden, Hunter wired some to Joe – Joe Biden will be arrested, not inaugurated
Date:  Mon, 28 Dec 2020 18:18:20 -0800
China wired $$$ to Hunter Biden, then Hunter wired $$$ to Joe – Joe Biden will be arrested, not inaugurated

jecbahoepjackhji
Hunter Biden in 2017 sent ‘best wishes’ from ‘entire Biden family’ to China firm chairman, requested $10M wire
https://www.foxnews.com/politics/hunter-biden-letter-chinese-cefc-chairman-wire-request
BIDEN TAPES REVEAL HUNTER AND JOE GUILTY OF SECRET CHINA DEALS!        https://themarshallreport.wordpress.com/2020/12/11/biden-tapes-reveal-hunter-and-joe-guilty-of-secret-china-deals/
Imposter Joe Biden must be arrested, prosecuted and incarcerated for the good of the Republic
https://www.sgtreport.com/2020/12/imposter-joe-biden-must-be-arrested-prosecuted-and-incarcerated-for-the-good-of-the-republic-2/

How Treasury Dept. tracked overseas cash pocketed by Hunter Biden
https://www.washingtontimes.com/news/2020/oct/4/how-treasury-dept-tracked-overseas-cash-pocketed-b/

Senate investigators: New records ‘confirm’ troubling Biden family links to China and Russia
https://www.washingtonexaminer.com/news/senate-investigators-new-records-confirm-troubling-biden-family-links-to-china-and-russia

The Biden Corruption Scandal Isn’t About Hunter, It’s About Joe
https://thefederalist.com/2020/10/19/the-biden-corruption-scandal-isnt-about-hunter-its-about-joe/

hgchjooijbglanhc

Hunter Biden’s addiction is not the issue. Joe Biden’s addiction is: His addiction to power and money.
And it is the evidence of the former vice president’s corruption, and the national security risk our country would face by electing Biden,
that is the story of the MacBook hard drive, not the salacious, verified photographs and videos of Hunter Biden.
Data and emails on Hunter Biden’s Laptop show everything.

And then Ukraine:

Ukraine releases Documents showing the Biden Crime Family robbed Ukraine People of Millions of Dollars
YouTube Press Release in Ukrainian with English Subtitles:  https://www.youtube.com/watch?v=hKDXVo-OKeQ&feature=emb_logo

New Files Released From Ukraine Reveals Biden, Obama Officials Allegedly
Got 17.5 MILLION Dollars Through Racketeering
https://thehill.com/opinion/campaign/463307-solomon-these-once-secret-memos-cast-doubt-on-joe-bidens-ukraine-story

Get Ukraine Docs on Biden from  https://www.scribd.com/user/259237201/JohnSolomon
https://rightwingtribune.com/2019/10/12/new-files-released/
https://www.foxnews.com/politics/documents-heighten-scrutiny-on-biden-ukraine-dealings-indicate-hunter-may-have-made-millions
https://www.breitbart.com/2020-election/2019/09/26/report-hundreds-of-documents-conflict-with-joe-bidens-account-of-why-ukrainian-prosecutor-was-fired/
Ukrainian Lawmaker Says Joe Biden Took $900k from Burisma While Still in Office, Claims To Have Documents Proving It
https://www.westernjournal.com/ukrainian-lawmaker-says-joe-biden-took-900k-burisma-still-office-claims-documents-proving/


The Biden Family also got massive Bribes from China

hitler

——– Forwarded Message ——–Subject:
PA House finds 200,000 bogus votes
Date:  Mon, 28 Dec 2020 17:26:52 -0800

PA House finds 200,000 bogus votes (next AZ, NV, WI, MI, GA)
https://hereistheevidence.com/election-2020/pa-update-records/
https://twitter.com/russdiamond/status/1343622485946880007
https://www.thegatewaypundit.com/2020/12/breaking-pennsylvania-certified-results-president-found-error-error-twice-size-difference-candidates/

After nearly two months, the state of Pennsylvania is found to have certified votes that are in error.
The Pennsylvania House has just uncovered that the certified results in Pennsylvania for President are in error by more than 200,000 votes.
This is more than twice the difference between President Trump and Joe Biden.

Stop the Steal!   https://stopthesteal.us/
Plot to Steal America Video – 17 minute Video
https://www.facebook.com/DonaldTrump/videos/219439113008326

bpgcngnphpkhekeh

Not just Corruption – actually Treason!  
Media Controls Public Opinion and even Censors the President.
Counterfeit Ballots, hacked Dominion Election-counting Software that weights votes more to Biden.
Shredded Ballots, all for Trump
—————————————————————-
Statement on Election Fraud by President Trump – 14 minute Video

https://www.facebook.com/DonaldTrump/videos/436515744393744
————————————————————————–

Watch Security Camera Videos that show the SAME Ballots stuffed into machines over and over again
https://www.thegatewaypundit.com/2020/12/president-trump-retweets-gateway-pundit-video-showing-poll-workers-stuffing-ballots-tabulators-numerous-times-election-night/
——————————————————————————–
Peter Navarro presents his report on Election Fraud
https://www.facebook.com/watch/?v=1723824047794927
36 page Navarro Report of Election Fraud in 6 States
https://www.thegatewaypundit.com/2020/12/theft-thousand-cuts-assistant-president-trump-peter-navarro-produces-report-fraud-2020-election/
https://phibetaiota.net/wp-content/uploads/2020/12/Navarro-Report-Six-Dimensions-Election-Irregularities.pdf
———————————————————————————
Summary of the Voter Fraud by OAN – 1-1/2 minutes

————————————————————————————–
Stop The Steal – 1 minute Video

https://www.facebook.com/DonaldTrump/videos/238598167675214
—————————————————————————————-
Georgia Poll Worker details the Fraud he saw – 2 minute Video

https://www.facebook.com/DonaldTrump/videos/230560558543713
—————————————————————————————
Fight for Trump – Save America, Save the World – 2 minute Video
https://www.facebook.com/153080620724/videos/2849119275359249

migcfghhfiefehin

How to Steal an Election – 1 minute Video
https://streamable.com/8cdi3o
A powerful video laying out the globalist plot to steal the 2020 presidential election starting with the release of the China Virus
went viral over the weekend after President Trump shared it on Twitter.
Twitter suspended the account of @CJTruth, the user who shared the video shortly after President Trump had retweeted it on Sunday.
https://banned.video/watch?id=5fdfdb96222e2d0828f87784

imcmhhbgkfcgpcmc

Dominion software deleted over 2.7 million votes nationwide, switched over 500,000 from Trump to Biden

https://www.naturalnews.com/2020-11-12-trump-bombshell-dominion-software-deleted-votes-switched-biden.html

ohmepboibgeebcjm

Watch Security Camera Videos that show the SAME Ballots stuffed into machines over and over again
https://www.thegatewaypundit.com/2020/12/president-trump-retweets-gateway-pundit-video-showing-poll-workers-stuffing-ballots-tabulators-numerous-times-election-night/
More on Trump’s WINs in Court and with State Legislatures
Listen to President Trump’s latest 6 minute speech
https://www.facebook.com/DonaldTrump/videos/436515744393744/?t=10

Will TRUMP be the NEXT LINCOLN?? Will TRUMP smash the DEEP STATE COUP??
1) Election Vote FRAUD is proven in many States
36 page Navarro Report of Election Fraud in 6 States
https://www.thegatewaypundit.com/2020/12/theft-thousand-cuts-assistant-president-trump-peter-navarro-produces-report-fraud-2020-election/
https://phibetaiota.net/wp-content/uploads/2020/12/Navarro-Report-Six-Dimensions-Election-Irregularities.pdf
 

6) Lawsuits continue in many States and Supreme Court
7) Some State Legislatures may overturn Fraudulent Election in their State (like PA now)

I can’t be the only one with problems with the added pork!


https://www.zerohedge.com/political/pork-city-here-are-most-ridiculous-pet-projects-900-billion-spending-package

Pork City: Here Are The Most Ridiculous Pet Projects In $900 Billion Stimulus Package

Tyler Durden's Photo
by Tyler Durden
Monday, Dec 21, 2020 – 17:40

As Congress prepares to pass a $900 billion COVID-19 stimulus bill rolled into a consolidated appropriations package – with funding for assistance for households and businesses, along with vaccine distribution and other pandemic-related measures, the bill also includes a ton of pork per usual.

Illustration via WSJ.com

https://www.zerohedge.com/political/pork-city-here-are-most-ridiculous-pet-projects-900-billion-spending-package
Pet Pork Projects in the $900 Billion Stimulus Package:
(What do these Pork Projects have to do with Covid Help???)
($50 Billion? in Ridiculous Pet Projects added to Covid Help Bill )
$453 Million to Ukraine
$10 Million for Gender Programs in Pakistan
$3.3 Billion to Israel
$1.3 Billion to Egypt
$700 Million to Sudan
$130 Million to Nepal
$135 Million to Burma
$85.5 Million to Cambodia
$1.4 Billion for Asia Reassurance
$4 Billion for Navy Weapons
$2 Billion for Space Force
$2 Billion for Air Force Missiles
$208 Million to upgrade Census Bureau computers to prep for 2030
$40 Million for the Kennedy Center
$193 Million for HIV/AIDS workers to buy cars and a museum

IF WE HAD 10 OF YOU WE’D RULE THE WORLD: BIDEN TO STACEY ABRAMS (VIDEO) — ARLIN REPORT……………….walking this path together

Originally posted on Burst Updates: Biden spoke at Georgia’s senate runoff campaign yesterday: “Stacey if we had 10 of you we could rule the whole world. God love ya. If you want to do the bidding of Texas, you should be running in Texas.” The dem goal is to beat GOP candidates Loeffler and Perdue…

IF WE HAD 10 OF YOU WE’D RULE THE WORLD: BIDEN TO STACEY ABRAMS (VIDEO) — ARLIN REPORT……………….walking this path together

Driving in the State of Florida

New Zealand Has Quatantine Camps. We Should Be Very Careful!

12/04/20

Mary + Polly Discuss AstraZeneca Vaccine Trial Volunteer, New Zealand ‘Quarantine Camps’ and More

In “This Week” with Mary Holland, Children’s Health Defense vice chair and general counsel, and Polly Tommey, co-producer of “Vaxxed,” Mary and Polly discuss the AstraZeneca vaccine trial participant who says he was injured, New Zealand “quarantine camps” … and more.

Mary + Polly Discuss AstraZeneca Vaccine Trial Volunteer, New Zealand ‘Quarantine Camps’ and More

Conversation-at-a-Glance

  • A participant in India’s AstraZeneca COVID vaccine trials reported to the Serum Institute, which is sponsoring the trial, that he developed acute neuro encephalopathy (a condition similar to what autistic children experience) after receiving the vaccine. “We should be very concerned about the tremendous levels of adverse events in all the COVID vaccine trials, and the obfuscation around who was in the trials.”
  • New Zealand is creating “quarantine camps” where people who test positive for COVID are held against their will until they test negative. “It’s extraordinary that a common law country like New Zealand is leading the charge in these draconian measures.”
  • In Portugal, the court ruled it illegal to force four German tourists into quarantine on the basis of a PCR test — which can give up to 97% false positives. Finland says it will not test healthy people, because there’s too much risk of false positives.
  • Brazil’s president, Jair Bolsonaro, said he will refuse the COVID vaccine. “Good for him, it’s an individual’s right anywhere to refuse unwanted medical intervention, and it’s the law here in the U.S.”
  • Employers can legally mandate the flu vaccine as a measure to prevent employees from getting COVID, but look for this issue to get more contentious. Some employers will also try to mandate COVID vaccines, “but I think legal cases against COVID vaccine mandates will succeed.”
  • Celebrities are being recruited to counter “anti-vaxxers” and guilt people into getting the vaccine “for the common good, for your mother, for your grandmother.” But we’ll have celebrities on our side, too, and they’ll talk about the potential for injuries without liability, and how for vaccine makers and others, “there are trillions of dollars at stake.”
  • In the UK, the British army says it will deploy its information warfare unit against “anti-vax propaganda.” But typically when a country starts deploying the military against its own citizens, “it doesn’t work for very long.”
  • Some good news last week: The Supreme Court said New York can’t restrict the number of people allowed to gather in churches and synagogues. The court ruled that the government can’t use a crisis to overrule the First Amendment.
  • There’s still time to contact the District of Columbia’s mayor and ask her to veto a bill, passed by Nov. 17 by the district’s city council that would allow children 11 and older to get a vaccine without parental consent. If this bill passes, Big Pharma will try to push it through all over the country. Even if you don’t live in D.C. please contact Mayor Bower. Go here for details.

Bill Gates Really Did Say It!

Yes, Bill Gates Said That. Here’s the Proof.

Gates and his minions insist the billionaire never said we’d need digital vaccine passports. But in a June 2020 TED Talk, Gates said exactly that. Someone edited out the statement, but CHD tracked down the original.

Yes, Bill Gates Said That. Here’s the Proof.

Some chiseler altered Bill Gates’ June 2020 TED Talk to edit out his revealing prediction that we will all soon need digital vaccine passports (slide 1). But after considerable effort, we tracked down the original video (slide 2).

Gates’ minions on cable and network news, his public broadcasting, social media and fact-checker toadies all now insist that Gates never said such things. They say he never intended to track and trace us with subdermal chips or injected tattoos.

They dismiss such talk as “conspiracy theories.”

Well, here it is from the horse’s mouth.

In 2019, according to a not-yet-purged Scientific American article, Gates commissioned the Massachusetts Institute of Technology to build an injectable quantum dot dye system to tattoo stored medical info beneath children’s skin. The tattoo was designed to be readable by an iPhone app.

Gates’ company, Microsoft, has patented a sinister technology that uses implanted chips with sensors that will monitor body and brain activity. It promises to reward compliant humans with crypto currency payments when they perform assigned activities.

Gates also invested approximately $20 million in MicroCHIPS, a company that makes chip-based devices, including birth-control implant chips with wireless on/off switches for remote-controlled drug-delivery by medical authorities.

In July 2019, months before the COVID pandemic, Gates bought 3.7M shares of Serco, a military contractor with U.S. and UK government contracts to track and trace pandemic infections and vaccine compliance.

To facilitate our transition to his surveillance society, Gates invested $1 billion in EarthNow, which promises to blanket the globe in 5G video surveillance satellites. EarthNow will launch 500 satellites allowing governments and large enterprises to live-stream monitor almost every “corner” of the Earth, providing instantaneous video feedback with one-second delay.

The Bill and Melinda Gates Foundation also acquired 5.3 million shares of Crown Castle, which owns 5G spy antennas including more than 40,000 cell towers and 65,000 small cells.

Please make your own copy of these clips — as Gates’ power to disappear inconvenient facts is expanding every digital day.

DEKALB COUNTY GA COVID-19

Image
https://www.dekalbhealth.net/covid-19/
The Georgia Department of Public Health (DPH) is closely monitoring an outbreak of respiratory illness caused by a novel (new) coronavirus (COVID-19) first identified in Wuhan, Hubei Province, China in December 2019, and regularly coordinating with the Centers for Disease Control and Prevention (CDC). The outbreak continues to grow in China and cases have been identified in a growing number of other international locations, including the United States.
Please review the resources and links below for information on COVID-19.


COVID-19 TESTING SITES IN DEKALB COUNTY


TESTING SITE
LOCATION
HOURS OF OPERATION
BrandsMart USA Parking Lot


Make an Appointment in English
Registro en Español
or call (404) 294-3700 Option 1 for an appointment
5000 Motors Industrial Way
Atlanta, Ga. 30360
Monday – Friday: 8:00 a.m. – 6:00 p.m.
Saturday: Closed
Sunday: Closed

*Thanksgiving Holiday Testing Hours*
November 25: 8 a.m. – 2 p.m.
November 26 – November 28: Closed


Former Sam’s Club Parking Lot


Make an Appointment in English
Registro en Español
or call (404) 294-3700 Option 1 for an appointment
2994 Turner Hill Rd
Stonecrest, Ga. 30038
Monday – Friday: 9:00 a.m. – 4:00 p.m.
Saturday: 9:00 a.m. – 12:00 p.m.
Sunday: Closed

*Thanksgiving Holiday Testing Hours*
November 25: 8 a.m. – 2 p.m.
November 26 – November 27: Closed
November 28: 9 a.m. – 12 noon
Greater Piney Grove Baptist Church


Make an Appointment in English
Registro en Español
or call (404) 294-3700 Option 1 for an appointment
1879 Glenwood Ave. SE
Atlanta, Ga. 30316
Monday – Friday: 10:00 a.m. – 3:00 p.m.
Saturday: Closed
Sunday: Closed

*Thanksgiving Holiday Testing Hours*
November 25: 8 a.m. – 2 p.m.
November 26 – November 28: Closed



COVID-19 TESTING
Use our online form to schedule an appointment for COVID-19 testing

COVID-19 CALL CENTER
Have COVID-19 questions? Call our call center to get answers

DEKALB COUNTY COVID-19 CASES
See the latest information on COVID-19 cases by zip code in DeKalb County

ESSENTIAL SERVICES
See what essential services are provided during the COVID-19 pandemic
Register Online
Call
View Cases
View Services

GOVERNOR’S OFFICE
View the latest Executive Orders

2020 Govenor’s Executive Orders

EXPANDED COVID-19 TESTING
View the latest information on expanded COVID-19 testing in Georgia and find your county’s direct patient line
Expanding COVID-19 Testing in GeorgiaCOVID-19 Testing – Direct Patient Lines

GEORGIA DEPARTMENT OF PUBLIC HEALTH COVID-19 INFORMATION
View the latest COVID-19 information and status report for Georgia
GA-DPH COVID-19 InformationGA COVID-19 Daily Status Report

CDC COVID-19 INFORMATION
Get the latest COVID-19 tips and resources from the CDC

CDC COVID-19 Information

ENVIRONMENTAL PROTECTION AGENCY (EPA) COVID-19 INFORMATION
View information on disinfectants that will work against COVID-19

EPA COVID-19 Information

COVID-19 RESTAURANT GUIDANCE
Restaurant Owner: View these important operation guidelines for COVID-19
COVID-19 Guidance for Restaurants

PRINT RESOURCES FOR COVID-19
View, print and share helpful resources and information regarding the Novel Coronavirus

COVID-19 Print Resources

COVID-19 VIDEO RESOURCES










HOAX

British Intelligence is a major part of Deep State Coup against Trump

Meet Lord Malloch Brown: The British Hand Behind The Coup To Oust Trump

https://www.zerohedge.com/geopolitical/meet-lord-malloch-brown-british-hand-behind-coup-oust-trump

From the obvious role of Sir Richard Dearlove and his former MI6 underlying Christopher Steele who together played a driving role in shaping the dodgy dossier,
to their involvement with Oxford Rhodes Scholar Strobe Talbott in composing, promoting and marketing the fraudulent dossier to targeted members of Congress and media,
to British Ambassador Sir Darroch caught “flooding the zone” with British intelligence assets to shape Trump’s perception of the world,
to the array of British entrapment operations that targeted Michael Flynn as early as 2014 in London
… wherever one looks, the hand of British intelligence seems to be everywhere.
———————————————
Is Lord Malloch’s name tied to the Canaanite god “Moloch”
that is worshipped by the Elite in Bohemian Grove with child sacrifices?
(In semitic languages, the vowels in a word are changed for variations – the core consonants are the basic part of the word.
https://en.wikipedia.org/wiki/Semitic_languages
For example, in Arabic, the root meaning “write” has the form k-t-b. From this root, words are formed by filling in the vowels and sometimes adding additional consonants,
e.g. كتاب kitāb “book”, كتب kutub “books”, كاتب kātib “writer”, كتّاب kuttāb “writers”, كتب kataba “he wrote”, يكتب yaktubu “he writes”, etc.)
Bohemian Grove

Continue reading “HOAX”

RedPill University: The Emperor Has No Clothes, and There is No Virus!

The Emperor Has no Clothes – and There is no Virus

4.9
(65)

David Icke Dares to say what many of us have suspected but were hesitant to speak publicly lest we be thought insane. Everyone by now is aware that the official narrative of COVID-19 is loaded with contradictions and fraud, but if the underlying concept, itself – the assertion that a deadly virus is stalking the human race – is not true, then we are facing something far more serious than bad science, poor judgement, and profiteering. If the contradictions and fraud are necessary to perpetuate a grand deception, then our response changes drastically. It changes because we no longer are engaged in a debate over the best way to cope with a global pandemic but in resisting a propaganda campaign to maneuver us into passively accepting a new normal of servitude to a global technocratic dictatorship. For the record, we think David is 100% correct.  2020 November 12 – Source: David Icke

RETURN TO HOME PAGE 

You can view this video from several sources. Cached versions are adjusted for optimum quality, if needed, and they provide access if original sources fail.

No Science to Support Mandatory Face Masks! What does it take to make the sheeple mad enough to wake up?

There Is No Science to Support Mandatory Face Masks. A Symbol of Social Submission?

As the distraction of BLM/Antifa riots and the coronavirus have consumed much attention and energy, the social engineering agenda of the World Economic Forum’s Great Reset has taken a giant step forward in establishing the mandatory face mask as a symbol of submission to their dehumanizing agenda.  Beyond Orwellian, the face mask is being used as a guise to re shape our perception of reality in acceptance of a scientific dictatorship as an integral part of a looming totalitarian globalist agenda.

As Democratic Governors have played a leading role in advancing the myth that face masks will save lives, Colorado Gov Jared Polis announced his decision on July 16th to mandate face masks to be worn in all public places in Colorado; thus codifying a medical tyranny world view.

In a July 12th Facebook page, Polis stated that “The emerging scientific data is clear” that wearing a mask protects others and reduces the risk of contracting Coronavirus.  Polis then referred to those resistant to a face mask as a “selfish bastard.”

During Polis’s four page Executive Order issued on July 19th, there is not one mention of the ‘emerging science’ as support for his decision to mandate face masks; nor does Polis discuss how health effects will improve with masking except as “mitigating effects of the pandemic.” In announcing the mandate, Polis declared that “Wearing a mask is not a political statement. I don’t know how, in anybody’s mind, this became a game of political football.”

If the Governor is truly at a loss as to how masking or other lockdown requirements became a political football, he has not been paying attention.  Consider the following: on March 20th, California became the first state in the country to order a Lockdown which was quickly followed by other States with Democratic Governors. To date, a majority of those Governors (21 out of 24) have all approved the mandatory wearing of face masks, albeit without applying any science.  It is the arbitrary ‘shutdown’ of business as well as onerous personal requirements (such as social distancing) with a State adopting  oppressive dictatorial behavior as if they have the right to make personal decisions about any one life.

Only four states with Republican Governors, some of which may be considered RINOs, have also adopted similar Executive Orders (Alabama, Arkansas, Massachusetts, Maryland).

*

If CV is merely a variation of an infectious virus, sunshine and warm weather should have already limited its impact; reducing its spread and exposure.  Instead, as Red States attempt to re open  (ie Texas and Florida), sudden intense  CV ‘hot spots’ flare which forces the State to delay and increase its shut down requirements.  Given an advanced radio frequency weapon ability, those ‘hot spots’ may have been generated by 5G at the millimeter level on the electro magnetic Spectrum.

If, in fact, science is not the prime reason for mandatory face masks; that is, if face masks do not provide safety from contagion, then why mandate face masks at all?  What other purpose does a face mask have but to protect the wearer or to inhibit spreading  the virus?  Without evidence that masks have positively reduced exposures and thereby fatalities, then the true purpose of the mandate becomes a more nefarious political and partisan gesture of psychological manipulation and control.

New England Journal of Medicine

On April 1st the prestigious New England Journal of Medicine published its Universal Masking Report including the following highlights:

  • We know that wearing a mask outside health care facilities offers little, if any, protection from infection.
  • The chance of catching Covid-19 from a passing interaction in a public space is therefore minimal.
  • In many cases, the desire for widespread masking is a reflexive reaction to anxiety over the pandemic.
  • The extent of marginal benefit of universal masking over and above these foundational measures is debatable.“
  • “What is clear, however, is that universal masking alone is not a panacea.
  • It is also clear that masks serve symbolic roles. Masks are not only tools, they are also talismans that may help increase health care workers’ perceived sense of safety, well-being, and trust in their hospitals. Although such reactions may not be strictly logical, we are all subject to fear and anxiety, especially during times of crisis. One might argue that fear and anxiety are better countered with data and education than with a marginally beneficial mask

No Scientific Support for Mask Wearing

Renowned nutritionist Dr. Joseph Mercola has recently reversed his earlier support of face masks and interviewed Dr. Denis Rancourt, PhD who examined the issue on behalf of the Ontario Civil Liberties Association.  Rancourt conducted extensive research with an emphasis on masks and did a thorough review of science literature concentrating on whether any evidence exists that masks can reduce infection risk of viral respiratory disease.  As a result of examining many controlled trials with verified outcomes,  he found no statistical advantage to wearing a mask or not wearing a mask and that masks do no inhibit viral spread.

Rancourt asserted that “there is no evidence that masks are of any utility for preventing infection by either stopping the aerosol particles from coming out, or from going in. You’re not helping the people around you by wearing a mask, and you’re not helping yourself avoid the disease by wearing a mask. In addition, Rancourt explained that “Infectious viral respiratory diseases primarily spread via very fine aerosol particles that are in suspension in the air.  Any mask that allows you to breathe therefore allows for transmission of aerosolized viruses.”

In conclusion, Rancourt stated

we’re in a state right now where the society is very gradually evolving towards totalitarianism.  As soon as you agree with an irrational order, an irrational command that is not science-based, then you are doing nothing to bring back society towards the free and democratic society that we should have.”

While the ACLU remains absent, OCLA (Ontario Civil Liberties Association) recommends Civil Disobedience against Mandatory Mask Laws.  If you are not comfortable with civil disobedience  and  your local food markets all require a face mask, don’t deny yourself the healthy food you and your family need – but DO find ways to  register your dissent against being forced to wear a face mask. Write a Letter to the Editor and contact all of your elected political leaders.  Be sure they understand  your objections that you will not comply with their unconstitutional and immoral behavior.

*

Note to readers: please click the share buttons above or below. Forward this article to your email lists. Crosspost on your blog site, internet forums. etc.

Renee Parsons served on the ACLU’s Florida State Board of Directors and as president of the ACLU Treasure Coast Chapter. She has been an elected public official in Colorado, an environmental lobbyist for Friends of the Earth and a staff member of the US House of Representatives in Washington DC. She can be found at reneedove3@yahoo.com.

Featured image: A woman wearing a face mask is seen in the subway in Milan, Italy, March 2, 2020. (Photo by Daniele Mascolo/Xinhua)


Comment on Global Research Articles on our Facebook page

Become a Member of Global Research

Federal lawsuit calls Tulsa’s mask ordinance unconstitutional and unhealthy for citizens

Federal lawsuit calls Tulsa’s mask ordinance unconstitutional and unhealthy for citizens
First amended complaint attached  –  read my www.Virus-Lies.com for more info
http://tulsabeacon.com/mask-lawsuit/
(Masks cause hypoxia by reducing Oxygen below 19.5% – in violation of OSHA directions – causes headaches, dizzyness, etc)
Doctor Robert Zoellner, Clay Clark, Doctor James Meehan, MD, and several Tulsa-based business owners have filed a federal lawsuit against Tulsa Mayor G.T. Bynum, the Executive Director of the Tulsa Health Department, Bruce Dart and the Tulsa City Council to immediately repeal the mask mandates that they claim are causing healthy people to become sick while trying to prevent the spread of a disease that is not a deadly threat to children and the vast majority of the general population.
According to the lawsuit, “The Court should invalidate and repeal Ordinance No. 24408 of the City of Tulsa (the ‘Tulsa Mask Mandate’) because face coverings create an ‘oxygen-deficient atmosphere,’ which the United States Department of Labor, Occupational Safety and Health Administration (OSHA) defines as an ‘atmosphere with an oxygen content below 19.5% by volume.’  Doctors, scientists, and other medical professionals will line up in this court to demonstrate and testify that face-covering lower oxygen levels in the immediate atmosphere of someone wearing face coverings to less than the Department of Labor’s required 19.5%, normally within less than ten (10) seconds.”
The Tulsa businessmen and doctors cite OSHA’s website that reads, “…rulemaking record for the Respiratory Protection Standard clearly justifies adopting the requirement that air breathed by employees must have an oxygen content of at least 19.5 percent.  A lesser concentration of oxygen in employees’ breathing air could endanger them physiologically and diminish their ability to cope with other hazards that may be present in the workplace.”
Zoellner and Clark cite U.S. Sen. Rand Paul, R-Kentucky, who recently stated, “If you look at under age 18, the mortality rate is about one in a million, if you look at age 18-45, the mortality rate is about 10 in 100,000. Above that, it increases, but interestingly, it is still pretty small, and the vast majority – even people up to 65 years of age, it may well be between 95 and 99 percent have a very mild case of this.
“So I’m not saying it’s a benign disease, people do get sick and die from this. But your chances are good.  We shouldn’t live in fear forever.  We should take normal precautions, we should assess the risks.  People who are older should take more precautions, but we shouldn’t, you know, cover the faces of our children and say you’re gonna have to live your whole life with your mask on.
“We shouldn’t do that, and the government definitely shouldn’t mandate it.”


Other Lawsuits:
1.      When informed that mandatory masking was a fraud, and therefore a felony, the Orange County board of Supervisors abandoned their mandatory mask policy, back on June 9th, 2020. www.thehealthyamerican.org
2.    The Florida Civil Rights Coalition has filed a lawsuit against Palm Beach County, citing the county’s mask mandate is “unlawful” and “infringes upon the well-settled constitutionally protected freedoms of over a million Palm Beach County residents.”
www.msn.com/en-us/news/us/lawsuit-filed-against-palm-beach-county-for-mask-mandate/ar-BB16aw3o
3.      Leon County Florida was sued over Mask Mandates:
https://tallahasseereports.com/2020/06/25/lawsuit-filed-to-stop-leon-county-mask-mandate/
4.      Georgia Governor Kemp sued Atlanta to stop them from illegally enforcing a local mask mandate, then changed to issue an executive order to stop them:
https://www.foxnews.com/politics/georgia-governor-drops-lawsuit-against-atlanta-mayor-over-mask-mandate
5.      A lawsuit filed in federal court challenges the constitutionality of Minnesota’s mask mandate by a group of Republican lawmakers and voters, including the watchdog group Minnesota Voters Alliance:
https://www.mprnews.org/story/2020/08/04/lawsuit-challenges-state-mask-mandate
6.      Conservatives sue Gov. Abbott to stop Texas’ mask mandate from being enforced:
https://www.star-telegram.com/news/politics-government/article243987762.html
7.     Lawsuit seeks to stop Ocala Florida face mask ordinance.  https://www.ocala.com/story/news/local/2020/08/14/lawsuit-seeks-to-stop-ocala-face-mask-ordinance/113192692/
8.     Harris Co. judge sued over mandatory mask order.  abc13.com/lina-hidalgo-sued-mask-houston/6125071/

  1. Lawsuit filed against the city of St. Augustine for Jeffrey Nager. who has asthma issues, which are aggravated by wearing a mask.   https://www.staugustine.com/story/news/coronavirus/2020/07/09/mask-mandates-spark-political-debate-in-st-johns-county/112699758/

masks

The facts I present in my www.Virus-Lies.com with links to evidence by Doctors, etc
Masks don’t stop tiny Viruses & small moisture: Link12345pdf
Masks make you sick: rebreathing CO2 & germs: Dr BlaylockLink2
Tests give false positives and test wrong thing: Link123
HydroxyChloroQuine HCQ best cure, not used so more Deaths:Link
If HCQ not used, Ventilators don’t work, but KILL: Link
Lockdowns only ruin Economy – more suicides & failed businesses.
CDC Director admits Lockdown Suicides More Threat than Covid 1
Deaths down & are lower than normal Flu

Deaths from Chlamydia Pneumonia Bacteria, not Virus: Link1,Link2
CDC admits 94% of Reported Deaths not “from” Covid19: Info
No Pandemic or Epidemic – only about 10,000 deaths “from” Covid19 now alleged (not 2 million or even 180,000), but deaths really from bacteria not treated with HCQ, usually Ventilator deaths

CovidDeaths_EthicalSkeptic-Just-Chart

More Tests give More “Cases” – So What?
Tests give false positives and test wrong thing: Link123

===============================================================================

Blaylock: Face Masks Pose Serious Risks To The Healthy

Image credit: engin akyurt on Unsplash

Blaylock: Face Masks Pose Serious Risks To The Healthy

image_pdfimage_print
Dr. Russell Blaylock warns that not only do face masks fail to protect the healthy from getting sick, but they also create serious health risks to the wearer. The bottom line is that if you are not sick, you should not wear a face mask.As businesses reopen, many are requiring shoppers and employees to wear a face mask. Costco, for instance, will not allow shoppers into the store without wearing a face mask. Many employers are requiring all employees to wear a face mask while at work. In some jurisdictions, all citizens must wear a face mask if they are outside of their own home.  ⁃ TN Editor

With the advent of the so-called COVID-19 pandemic, we have seen a number of medical practices that have little or no scientific support as regards reducing the spread of this infection. One of these measures is the wearing of facial masks, either a surgical-type mask, bandana or N95 respirator mask. When this pandemic began and we knew little about the virus itself or its epidemiologic behavior, it was assumed that it would behave, in terms of spread among communities, like other respiratory viruses. Little has presented itself after intense study of this virus and its behavior to change this perception.

This is somewhat of an unusual virus in that for the vast majority of people infected by the virus, one experiences either no illness (asymptomatic) or very little sickness. Only a very small number of people are at risk of a potentially serious outcome from the infection—mainly those with underlying serious medical conditions in conjunction with advanced age and frailty, those with immune compromising conditions and nursing home patients near the end of their lives. There is growing evidence that the treatment protocol issued to treating doctors by the Center for Disease Control and Prevention (CDC), mainly intubation and use of a ventilator (respirator), may have contributed significantly to the high death rate in these select individuals.

By wearing a mask, the exhaled viruses will not be able to escape and will concentrate in the nasal passages, enter the olfactory nerves and travel into the brain.

Russell Blaylock, MD

As for the scientific support for the use of face mask, a recent careful examination of the literature, in which 17 of the best studies were analyzed, concluded that, “ None of the studies established a conclusive relationship between mask/respirator use and protection against influenza infection.”1   Keep in mind, no studies have been done to demonstrate that either a cloth mask or the N95 mask has any effect on transmission of the COVID-19 virus. Any recommendations, therefore, have to be based on studies of influenza virus transmission. And, as you have seen, there is no conclusive evidence of their efficiency in controlling flu virus transmission.

It is also instructive to know that until recently, the CDC did not recommend wearing a face mask or covering of any kind, unless a person was known to be infected, that is, until recently. Non-infected people need not wear a mask. When a person has TB we have them wear a mask, not the entire community of non-infected. The recommendations by the CDC and the WHO are not based on any studies of this virus and have never been used to contain any other virus pandemic or epidemic in history.

Now that we have established that there is no scientific evidence necessitating the wearing of a face mask for prevention, are there dangers to wearing a face mask, especially for long periods? Several studies have indeed found significant problems with wearing such a mask. This can vary from headaches, to increased airway resistance, carbon dioxide accumulation, to hypoxia, all the way to serious life-threatening complications.

There is a difference between the N95 respirator mask and the surgical mask (cloth or paper mask) in terms of side effects. The N95 mask, which filters out 95% of particles with a median diameter >0.3 µm2 , because it impairs respiratory exchange (breathing) to a greater degree than a soft mask, and is more often associated with headaches. In one such study, researchers surveyed 212 healthcare workers (47 males and 165 females) asking about presence of headaches with N95 mask use, duration of the headaches, type of headaches and if the person had preexisting headaches.2

How is Coronavirus Getting Into the Brain?

Vaccine Reaction

They found that about a third of the workers developed headaches with use of the mask, most had preexisting headaches that were worsened by the mask wearing, and 60% required pain medications for relief. As to the cause of the headaches, while straps and pressure from the mask could be causative, the bulk of the evidence points toward hypoxia and/or hypercapnia as the cause. That is, a reduction in blood oxygenation (hypoxia) or an elevation in blood C02 (hypercapnia). It is known that the N95 mask, if worn for hours, can reduce blood oxygenation as much as 20%, which can lead to a loss of consciousness, as happened to the hapless fellow driving around alone in his car wearing an N95 mask, causing him to pass out, and to crash his car and sustain injuries. I am sure that we have several cases of elderly individuals or any person with poor lung function passing out, hitting their head. This, of course, can lead to death.

A more recent study involving 159 healthcare workers aged 21 to 35 years of age found that 81% developed headaches from wearing a face mask.3   Some had pre-existing headaches that were precipitated by the masks. All felt like the headaches affected their work performance.

Unfortunately, no one is telling the frail elderly and those with lung diseases, such as COPD, emphysema or pulmonary fibrosis, of these dangers when wearing a facial mask of any kind—which can cause a severe worsening of lung function. This also includes lung cancer patients and people having had lung surgery, especially with partial resection or even the removal of a whole lung.

While most agree that the N95 mask can cause significant hypoxia and hypercapnia, another study of surgical masks found significant reductions in blood oxygen as well. In this study, researchers examined the blood oxygen levels in 53 surgeons using an oximeter. They measured blood oxygenation before surgery as well as at the end of surgeries.4 The researchers found that the mask reduced the blood oxygen levels (pa02) significantly. The longer the duration of wearing the mask, the greater the fall in blood oxygen levels.

The importance of these findings is that a drop in oxygen levels (hypoxia) is associated with an impairment in immunity. Studies have shown that hypoxia can inhibit the type of main immune cells used to fight viral infections called the CD4+ T-lymphocyte. This occurs because the hypoxia increases the level of a compound called hypoxia inducible factor-1 (HIF-1), which inhibits T-lymphocytes and stimulates a powerful immune inhibitor cell called the Tregs. . This sets the stage for contracting any infection, including COVID-19 and making the consequences of that infection much graver. In essence, your mask may very well put you at an increased risk of infections and if so, having a much worse outcome.5,6,7

People with cancer, especially if the cancer has spread, will be at a further risk from prolonged hypoxia as the cancer grows best in a microenvironment that is low in oxygen. Low oxygen also promotes inflammation which can promote the growth, invasion and spread of cancers.8,9  Repeated episodes of hypoxia has been proposed as a significant factor in atherosclerosis and hence increases all cardiovascular (heart attacks) and cerebrovascular (strokes) diseases.10

There is another danger to wearing these masks on a daily basis, especially if worn for several hours. When a person is infected with a respiratory virus, they will expel some of the virus with each breath. If they are wearing a mask, especially an N95 mask or other tightly fitting mask, they will be constantly rebreathing the viruses, raising the concentration of the virus in the lungs and the nasal passages. We know that people who have the worst reactions to the coronavirus have the highest concentrations of the virus early on. And this leads to the deadly cytokine storm in a selected number.

It gets even more frightening. Newer evidence suggests that in some cases the virus can enter the brain.11,12 In most instances it enters the brain by way of the olfactory nerves (smell nerves), which connect directly with the area of the brain dealing with recent memory and memory consolidation. By wearing a mask, the exhaled viruses will not be able to escape and will concentrate in the nasal passages, enter the olfactory nerves and travel into the brain.13

It is evident from this review that there is insufficient evidence that wearing a mask of any kind can have a significant impact in preventing the spread of this virus. The fact that this virus is a relatively benign infection for the vast majority of the population and that most of the at-risk group also survive, from an infectious disease and epidemiological standpoint, by letting the virus spread through the healthier population we will reach a herd immunity level rather quickly that will end this pandemic quickly and prevent a return next winter. During this time, we need to protect the at-risk population by avoiding close contact, boosting their immunity with compounds that boost cellular immunity and in general, care for them.

One should not attack and insult those who have chosen not to wear a mask, as these studies suggest that is the wise choice to make.

References

  1. bin-Reza F et al. The use of mask and respirators to prevent transmission of influenza: A systematic review of the scientific evidence. Resp Viruses 2012;6(4):257-67.
  2. Zhu JH et al. Effects of long-duration wearing of N95 respirator and surgical facemask: a pilot study. J Lung Pulm Resp Res 2014:4:97-100.
  3. Ong JJY et al. Headaches associated with personal protective equipment- A cross-sectional study among frontline healthcare workers during COVID-19. Headache 2020;60(5):864-877.
  4. Bader A et al. Preliminary report on surgical mask induced deoxygenation during major surgery. Neurocirugia 2008;19:12-126.
  5. Shehade H et al. Cutting edge: Hypoxia-Inducible Factor-1 negatively regulates Th1 function. J Immunol 2015;195:1372-1376.
  6. Westendorf AM et al. Hypoxia enhances immunosuppression by inhibiting CD4+ effector T cell function and promoting Treg activity. Cell Physiol Biochem 2017;41:1271-84.
  7. Sceneay J et al. Hypoxia-driven immunosuppression contributes to the pre-metastatic niche. Oncoimmunology 2013;2:1 e22355.
  8. Blaylock RL. Immunoexcitatory mechanisms in glioma proliferation, invasion and occasional metastasis. Surg Neurol Inter 2013;4:15.
  9. Aggarwal BB. Nucler factor-kappaB: The enemy within. Cancer Cell 2004;6:203-208.
  10. Savransky V et al. Chronic intermittent hypoxia induces atherosclerosis. Am J Resp Crit Care Med 2007;175:1290-1297.
  11. Baig AM et al. Evidence of the COVID-19 virus targeting the CNS: Tissue distribution, host-virus interaction, and proposed neurotropic mechanisms. ACS Chem Neurosci 2020;11:7:995-998.
  12. Wu Y et al. Nervous system involvement after infection with COVID-19 and other coronaviruses. Brain Behavior, and Immunity, In press.
  13. Perlman S et al. Spread of a neurotropic murine coronavirus into the CNS via the trigeminal and olfactory nerves. Virology 1989;170:556-560.

Dr. Russell Blaylock, author of The Blaylock Wellness Report newsletter, is a nationally recognized board-certified neurosurgeon, health practitioner, author, and lecturer. He attended the Louisiana State University School of Medicine and completed his internship and neurological residency at the Medical University of South Carolina. For 26 years, practiced neurosurgery in addition to having a nutritional practice. He recently retired from his neurosurgical duties to devote his full attention to nutritional research. Dr. Blaylock has authored four books, Excitotoxins: The Taste That KillsHealth and Nutrition Secrets That Can Save Your LifeNatural Strategies for Cancer Patients, and his most recent work, Cellular and Molecular Biology of Autism Spectrum Disorders.

Do I Need Say More??? Quit Drinking Fluoridated Water and Watching the TV News! You Will Wake Up a Communist Being Tortured

A Must Read! Cease and Desist Your Mandatory Mask Policy by Jason Hommel

CEASE AND DESIST YOUR MANDATORY MASK POLICY

Jason Hommel
(530) 559 2974

 

CEASE AND DESIST YOUR MANDATORY MASK POLICY

On 7-31-2020, just before 1:30pm in the afternoon, my wife and I were asked to leave the Sprouts Store located on 82nd and Quaker, in Lubbock, TX, because they specifically said they do not recognize medical exemptions to wearing masks. We were wearing medical exemption badges, which are not required by law to be worn, to help inform others. I was given a store policy sheet, and I was invited to shop online, from home.

I hereby demand that you cease and desist requiring wearing masks to shop at your stores owned and operated by Sprouts Farmers Market, Inc.

I hereby demand that you stop violating the law in numerous ways, as follows.

  1. You are in violation of both the City of Lubbock and the State of Texas masking laws, both of which make provisions for medical exemptions. You are not allowing medical exemptions, in violation of both laws, laws which you are fraudulently attempting to enforce.

1A. You are not a police officer. You are not empowered to enforce laws.

  1. You are practicing medicine without a licence, which illegal in all States in America, which is a felony, and carries with it a prison term from 1 to 8 years. A mask to prevent viral transmission is a medical intervetion that carries with it risks, such as reduced oxygen intake, increased CO2 intake, increased risk of viral and bacterial and fungal lung infections, fungal face infections, and potential brain damage from reduced oxygen. A list of up to 131 scientific articles and reasons to avoid wearing a mask can be found online at https://revealingfraud.com/2020/05/health/refuse/ You are overriding both the science, the law, and other doctor’s orders, in overriding the legal medical exemptions, without a medical license, in violation of numerous laws. When engaged in practicing medicine without a licence, you can be sued for damages that your advice might cause, there not need be any actual damages. You can be sued for “possible brain damage” that often carries rewards exceeding $1-10 million dollars in damages, and you can be held personally and corporately liable. I hereby again claim my own medical exemption, and I’m not required by law to tell you my medical history, nor are you allowed to ask, because of medical privacy laws protected by HIPAA. But my medical history is published online at revealingfraud.com anyway.

2.(A) Medical Professionals can only “prescribe” medical procedures, which means to give advice. They are not even legally allowed to mandate a medical procedure. In order for Doctors to mandate a medical procedure, they first need to either obtain a medical power of attorney document over a patient, and/or declare the person unconscious and/or unfit to decline a life saving procedure. You neither have a medial power of attorney over me, nor have I hired you to be my doctor, nor am I unconscious. Nor am I mentally compromised in any way. By wearing a mask, you restrict your own oxygen, and you mentally compromise yourself. You might want to take off your mask, and take a few deep breaths to get oxygen to your brain, to help you understand the rest of this.

  1. You are violating the ADA Act, the Americans with Disabilities Act, that requires that you make reasonable accommodation to those with disabilities that could include numerous medical disabilities that could prevent people from wearing masks, such as, but not limited to, the following: asthma, allergies, anemia, fungal infections, blood clotting disorders, diabetes, PTSD, autism, pre existing lung problems, “being a human”, and needing to meet basic OSHA air quality requirements of more then 19.5% oxygen, and less then 400 parts per million CO2. Masks have been shown to reduce oxygen to 18% and increase CO2 to over 10,000 ppm.

3.(A) To help you understand the level of offense of your illegal discrimination, try demanding that black people not enter your store on the basis that give off particles that are offensive, and requiring them to shop at home. That is as offensive as refusing service to those not wearing masks for reasons of a medical exemption. The ADA also requires you to make reasonable accommodations for people with a religious exemption to wearing masks, because discrimination based on religion is also illegal.

  1. Your demand that customers wear masks, with no medical exemptions, fraudulently assumes that masks work. They do not. Air easily slips around all masks, such as the very large air gaps around the nose, cheeks and chin. Furthermore, the particle size of the coronavirus is typically 1/1000th of the size of the spacing between threads of the mask itself. A coronavirus is 0.1 microns. Holes in cloth masks are up to 100 microns. If you “zoom in” this is like expecting two threads, spaced as far apart as three football fields, 900 feet, to filter out a shoe the size of one foot. That is insane. Furthermore, there are 1000 microns per millimeter. The air gaps around the mask, by the nose, if they are half a centimeter, are 5000 microns. A coronavirus is 0.1 microns. The difference is 50,000 times in size. This gap is so big, and the virus is so small, it’s like two lines, 10 miles apart, (52,800 feet) trying to filter out a basketball (just under a foot). Mask wearing is mental insanity. In both theory and actual fact, masks cannot possibly work to do what you expect them to do, so your position is not based on science, but rather, irrational fear, and irrational expectations that masks work, when they cannot. Since your position is based on insanity and the fraud that masks work, it cannot be said to follow the law and be “reasonable”. Furthermore, restaurants are open, with up to 60-100 people eating at once, with nobody wearing a mask while eating, and that fully complies with the law. So how could one person not wearing a mask in a grocery store be a danger compared to that? Fraud also carries with it a prison sentence, as fraud is a felony.
  2. When informed that mandatory masking was a fraud, and therefore a felony, the Orange County board of Supervisors abandoned their mandatory mask policy, back on June 9th, 2020. https://www.thehealthyamerican.org/
  3. The COVID19 scare is a fraud, from top to bottom. Politicians and the Media are immune from the consequences of lying, but commercial stores have no such immunity from practicing fraud. COVID19 is fraud for the following reasons.

A. The test kits do not work. The tests have a 50% to 80% false positive rate.

B. The rate of positives has always been about 10%, from the very beginning of the crisis. The rate of people testing positive has not gone up, they have only increased the number and rate of tests given.

C. The test kits have been reported to be contaminated. June 23, 2020: https://www.webmd.com/lung/news/20200623/early-cdc-covid-19-test-kits-likely-contaminated Unswabbed swabs are reported to test positive.

Nurses’ Lawsuit Claims ‘Fabricated’ COVID-19 Tests at Georgia Hospital
Max Blau June 22, 2020 https://www.medscape.com/viewarticle/932722

D. While “confirmed case” counts have been going up, there is no such thing as a “confirmed case” because the test kits say directly on them “not to be used for diagnostic purposes” and therefore a fraudulent test with a high false positive rate cannot “confirm” anything.

  1. To determine the lethality of any disease, they need to compare cases to deaths. Both numbers suffer from massive fraud. Regarding death counts:

A. The death counts are overinflated, as States have been directed by the CDC to include presumptive or presumed cases that would not even include the fraudulent test kit non confirmation, which, itself, over counts things with that false positive rate of from 50% to 80%. “COVID-19 should be reported on the death certificate for all decedents where the disease caused or is assumed to have caused or contributed to death.” https://www.cdc.gov/nchs/data/nvss/coronavirus/Alert-2-New-ICD-code-introduced-for-COVID-19-deaths.pdf

Furthermore, Birx says government is classifying all coronavirus death cases as COVID19 caused deaths, regardless of the cause, such as underlying health issues. See point B for further corroboration. https://www.foxnews.com/politics/birx-says-government-is-classifying-all-deaths-of-patients-with-coronavirus-as-covid-19-deaths-regardless-of-cause

B. Other nations have determined that 99% of their “died with COVID” cases did not die “from COVID” as 99% of other patients were elderly and had from 1-4 other co-morbid chronic conditions. If that is true, it takes the real death rate down to nearly nothing. This was reported by Bloomberg, back on March 18th, which basically shows and admits that this is all a media hoax. https://www.bloomberg.com/news/articles/2020-03-18/99-of-those-who-died-from-virus-had-other-illness-italy-says

C. The real death counts are not higher than the rate of normal rates of pnumonia. People vastly overestimate their chances of “catching” COVID, and vastly overestimate their chances of death, with younger people, aged 18-34 giving the highest estimations, at 90% estimated chances of catching it, and a 20% chance of death if they do catch it. https://www.nber.org/papers/w27494.pdf see chart on p. 12. These estimates would have COVID killing about 328 million x .9 x .2 = 59 million Americans. Even the White House estimations of the deaths of 2 million Americans were vastly over exaggerated, and the man responsible for that model resigned in disgrace. The “official” death toll, which is grossly over exaggerated, for multiple reasons, as I am going over, stands at 137,922, per the CDC as of July 31: https://www.cdc.gov/nchs/nvss/vsrr/covid19/index.htm see Table 1. That is a total death rate of the population of 0.04%, which is substantially lower than the CDC’s latest death rate estimate last month of 0.26%. Typical flu deaths in a year vary from 50,000 to 80,000.

D. Death counts are inflated from putting people into a very risky coma plus a ventilator, and that process kills people from 88% to 90% of the time. https://ktla.com/news/nationworld/nearly-90-of-covid-19-patients-put-on-ventilators-in-new-yorks-largest-health-system-died-study-finds/

E. The real death rate could well be 137,922 x 1% (no comorbidities) x 50% due to false positives, which would be 689! Given that there is no higher overall death rate than normal, the risk from a fraudulent disease that is not increasing the total death rate is zero. A real pandemic would not require fraudulently overstating things at all levels, from test kits that don’t work, to fraudulently claiming an increase in the infected, to inflated death counts, to masks that don’t work.

F. The false pandemic is a “live exercise” planned in advance, in October 18th, 2019. https://www.centerforhealthsecurity.org/event201/

  1. People with honor do not practice nor support games of fraud. If managers wish to stop participating in the COVID media lies, they may wish to remind their employer of the Civil Rights Act of 1964 which makes it illegal to discriminate based on religious beliefs. Sections 703 A(1)(2). My own religious beliefs also prohibit me from participating in fraud, or from lying in any way.
  2. Managers of businesses cannot be hired to break the law. You may have been told by a supervisor to “enforce store policy”, but you cannot be hired to break the law nor be hired to commit one felony, let alone multiple felonies. You always have the right to tell your supervisor, “You cannot legally require me to break the law.” You may wish to present this letter to your immediate supervisors and/or human resources department, and/or legal department and/or corporate board and/or company owners.
  3. Even if you were a doctor, and a lawyer, and a police officer, you would still not have the right to demand that free people wear masks to shop at your store.
  4. Even if you petitioned congress to change all the laws above, you would still not have the right to trample on people’s Constitutional rights, and it would remain unwise to do so.
  5. Numerous “emergency COVID orders” have already been struck down as un-Constitutional in various other states.
  6. Several other large retailers in Lubbock, at their corporate level, such as Market Street United Supermarkets and Wal-Mart, have decided to honor medical exemptions to mask wearing, presumably because they have been informed of the legal issues involved, or maybe because they are already involved in litigation over it, and are engaged in actions designed to settle the disputes.
  7. After having been informed of the law, such as through a cease and desist letter like this one, if you continue to violate the law, it will be presumed that you are “willfully” violating the law, which often carries with it additional penalties, such as double the criminal prison sentence to be served, and/or double the civil fines to be paid.

Sincerely,

Jason Hommel

Post navigation

You know my response.  It would take one of the masks below, to protect you from a deadly disease spreading.  The stupid little masks that people wear, does not even cover their eyes. 
Is common sense so lacking for people?
 
Damn it sheeple wake up, you act like idiots.

fullfacemasks

Flynn, Durham, Trump and JFK, Jr. Dallas 10/17

jfk-jr-1-435

Robert David Steele: New Video on JFK Jr. Joining President Trump in Dallas on 17 October; Flynn, Durham
Monday, August 10, 2020 12:39

Robert David Steele: New Video on JFK Jr. Joining President Trump in Dallas on 17 October; Flynn, Durham

𝗔𝗯𝗼𝘂𝘁 𝗧𝗵𝗶𝘀 𝗜𝗻𝘁𝗲𝗿𝘃𝗶𝗲𝘄

In five minutes Robert David Steele…

Discusses his near-term expectations on Flynn case and Durham indictments, lists three areas where he is disappointed in Trump’s Administration, and concludes with pointers to two new free websites on naked short selling and pedophilia & empire (with a tag cloud of names).

Before you vote let this sink in — Jim Campbell’s

By Jim Campbell Aug. 28th 2030 Predictably it did, President Trumps Executive Order helped greatly No one who lived through the progressive reign of Dr. Do Little will forget this. They haven’t changed today. A vote for Biden is a one way ticket to the socialist state. The trains only run in one direction, but […]

Before you vote let this sink in — Jim Campbell’s