COVID 19 – Evidence Of Global Fraud, POSTED BY: IAIN NOVEMBER 16, 2020

COVID 19 – Evidence Of Global Fraud

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery.  Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this “parasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

Identification of What Exactly?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2020.

The WHO’s Laboratory testing guidance states:

“The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

“The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020……On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

“Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from “sequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to “isolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the U.S. CDC “infected” various cells with the novel virus they noted the following:

“We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]……No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]…….HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

It is not clear that SARS-CoV-2 is a human virus capable of causing widespread illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

Voyage Of Discovery

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of “unkown origin.”

E Gene target sequence

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

“Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just “there.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

Isolate Nothing

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

“The reliability of COVID-19 tests is uncertain due to the limited evidence base…There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

“Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

“PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

“Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:

“…No quantified virus isolates of the 2019-nCoV are currently available……..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must except pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

Testing For Nothing

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19. While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the “virus”. These include:

  • RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
  • S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
  • E gene (Orf1ab) – small membrane protein used in viral assembly
  • N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome. Using a slew of strawman arguments like, “this claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and reverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used……One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called “junk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

Conclusive Fraud

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised .

Prince Charles telling us to embrace the Great Reset

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called “new normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocent they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

01/15/21

WHO: No Guarantee COVID Vaccines Will Prevent People From Being Infected

At a virtual press conference held by the World Health Organization officials warned there is no clear evidence COVID-19 vaccines are effective at preventing asymptomatic infection and transmission.

Story at-a-glance:

  • The World Health Organization (WHO) warned there is no guarantee that COVID-19 vaccines will prevent people from being infected with the SARS-CoV-2 virus and transmitting it to other people.
  • Vaccinated persons still need to mask and social distance because they could be able to spread the new coronavirus to others without knowing it, according to WHO and U.S. health officials.
  • As with measles and polio, there is no guarantee of eliminating the SARS-CoV-2 virus through mass vaccination programs.
  • There is a possibility the U.S. government will introduce “COVID-19 vaccine passports” and that some local governments and businesses will make COVID-19 vaccines mandatory, including in schools.
  • Technology companies have been working on creating a digital certificate, which contains personal medical information giving evidence that an individual has been vaccinated and which can be used as a screening tool by employers and businesses.

At a virtual press conference held by the WHO Dec. 28, 2020, officials warned there is no guarantee that COVID-19 vaccines will prevent people from being infected with the SARS-CoV-2 virus and transmitting it to other people.

In a New Year’s Day interview with Newsweek, Dr. Anthony Fauci, director of the National Institute of Allergy and Infectious Diseases, reinforced the WHO’s admission that health officials do not know if COVID-19 vaccines prevent infection or if people can spread the virus to others after getting vaccinated.

According to U.S. and WHO health officials, vaccinated persons still need to mask and social distance because they could be able to spread the new coronavirus to others without knowing it.

Although the U.S. Food and Drug Administration granted Emergency Use Authorization in December 2020 for Pfizer/BioNTech and Moderna to release their experimental mRNA vaccines for use in the U.S., the companies only provided evidence from clinical trials to demonstrate that, compared to unvaccinated trial participants, their vaccines prevented more mild to severe COVID-19 disease symptoms in vaccinated participants.

The companies did not investigate whether the vaccines prevent people from becoming asymptomatically infected with the SARS-CoV-2 virus and/or transmitting it to other people.

COVID-19 vaccines designed to prevent severe disease

According to WHO officials, while it appears the vaccines can prevent clinically symptomatic COVID-19 clinical disease, there is no clear evidence COVID-19 vaccines are effective at preventing asymptomatic infection and transmission. During the press conference, WHO chief scientist and pediatrician Dr. Soumya Swaminathan said:

“We continue to wait for more results from the vaccine trials to really understand whether the vaccines, apart from preventing symptomatic disease and severe disease and deaths, whether they’re also going to reduce infection or prevent people from getting infected with the virus, then from passing it on or transmitting it to other people.

I don’t believe we have the evidence on any of the vaccines to be confident that it’s going to prevent people from actually getting the infection and therefore being able to pass it on.”

Swaminathan said the COVID-19 vaccine was designed to first prevent symptomatic disease, severe disease and deaths. Dr. Mark Ryan, MPH, who is executive director of the WHO Health Emergencies Program, agreed with Swaminathan and added:

“So the first primary objective is to decrease the impact the disease is having on people’s lives and, therefore, that will be a major step forward in bringing the world back to some kind of normal.

The second phase is then looking at how will this vaccine affect transmission. We just don’t know enough yet about length of protection and other things to be absolutely able to predict that, but we should be able to get good control of the virus.”

SARS-CoV-2 eradication via mass vaccination is a ‘moonshot’

Ryan also pointed out that the decision by WHO to try to eradicate the SARS-CoV-2 virus “requires a much higher degree of efficiency and effectiveness in the vaccination program and the other control measures” and that it is likely the new coronavirus will “become another endemic virus, a virus that will remain somewhat of a threat but a very low level threat in the context of an effective vaccination program.”

Ryan cautioned that, like with measles and polio, there is no guarantee of eliminating the SARS-CoV-2 virus through mass vaccination programs. He said:

“The existence of a vaccine even at high efficacy is no guarantee of eliminating or eradicating an infectious disease. That’s a very high bar for us to be able to get over. First, we have to focus on saving lives, getting good control of this epidemic, and then we will deal with the moonshot of potentially being able to eliminate or eradicate this virus.”

Azar says get vaccinated but still mask up

In a Dec.  22, 2020 interview, HHS Secretary Alex Azar told Fox News that the current “consensus” among health officials is that people who get two doses of COVID-19 vaccine should still mask up and practice social distancing. He said:

“We’re still studying some fundamental scientific questions though, such as, once you’ve been vaccinated, do you still need to wear a mask to protect others, could you still be carrying the virus even though you’re protected from it …

“If you’re getting vaccinated right now, still social distance, still wear a mask, but all these [recommendations] have to be data and science-driven, so we’re working to generate the data there so that as we go forward, we’ll be able to advise people on a foundation of data.”

COVID-19 vaccine passports and mandates may be coming

In an interview on CNN in early April 2020 when most states were in some form of a coronavirus lockdown, Fauci told Alyson Camerota, “It’s very likely that there are a large number of people out there that have been infected, have been asymptomatic, and did not know they were infected.”

Eight months later, on New Year’s Day 2021, Fauci told Newsweek that in his role as the new administration’s chief medical adviser, there is a possibility the federal government will eventually introduce “COVID-19 vaccine passports” and that some city, county or state governments and businesses will make COVID-19 vaccines mandatory, including in schools.

“Everything will be on the table,” Fauci declared. A week earlier, Fauci told The New York Times that between 70% and 90% of the U.S. population would need to get COVID-19 vaccinations in order for the country to reach vaccine-acquired herd immunity. He explained why he has continued to shift the “herd immunity” goal post over the past year:

“When polls said only about half of all Americans would take a vaccine, I was saying herd immunity would take 70 to 75 percent. Then, when newer surveys said 60 percent or more would take it, I thought, ‘I can nudge this up a bit,’ so I went to 80, 85 … We really don’t know what the real number is. I think the real range is somewhere between 70 to 90 percent. But, I’m not going to say 90 percent.”

Even as Fauci discussed vaccine passports and mandates in Newsweek, he admitted that proving that COVID-19 vaccines do more than prevent clinical disease but also block infection and transmission has been elusive. He emphasized that persons who get vaccinated still must wear masks:

“We do not know if the vaccines that prevent clinical disease also prevent infection. They very well might, but we have not proven that yet … That’s the reason I keep saying that even though you get vaccinated, we should not eliminate, at all, public health measures like wearing masks because we don’t know yet what the effect [of the vaccine] is on transmissibility.”

Fauci added, “We don’t know what we don’t know.”

Immunity passports: suggested soon after the pandemic began

Government health officials in Israel are getting ready to issue a COVID-19 “green passport” to citizens who have received two COVID-19 shots, which will exempt them from travel restrictions and testing for infection with the SARS-CoV-2 virus or being required to quarantine after exposure to an infected person.

Technology companies have been working on creating a digital certificate, which contains personal medical information giving evidence that an individual has been vaccinated and can be used as a screening tool by employers, businesses and owners or operators of services and public venues, such as airlinestheme parksconcert halls, hotels and other places where people gather in groups with other people.

Immediately after the coronavirus pandemic was declared by the WHO last winter, Silicon Valley businessman Bill Gates began talking about the need for issuing digital certificates proving immunity to the virus and, once a COVID-19 vaccine becomes available, proof of vaccination.

In a comment posted on Reddit in March 2020, Gates said, “Eventually we will have some digital certificates to show who has recovered or been tested recently or when we have a vaccine who has received it.”

That same month in a TED Talk, Gates explained how lockdowns and resulting “economic pain” will prevent people from getting naturally acquired immunity to the SARS-CoV-2 virus and that immunity “certificates” will eventually be required. Gates said:

“Now we don’t want to have a lot of recovered people, you know. To be clear, we’re trying through the shutdown in the United States, to not get to one percent of the population infected. We’re well below that today, but with exponentiation you could get past that three million. I believe we will be able to avoid that with having this economic pain.

“Eventually, what we’ll have to have is certificates of who is a recovered person, who’s a vaccinated person, because you don’t want people moving around the world where you’ll have some countries that won’t have it under control, sadly. You don’t want to completely block off the ability for people to go there and come back and move around.”

In an April 9, 2020, interview on National Public Radio, Gates returned to the message that some “social distancing” measures have to stay in place “until we get a vaccine that almost everybody’s had.” He said:

“What I’m saying, what Dr. Anthony Fauci is saying, what some other experts are saying, there’s a great deal of consistency. We’re not sure yet which activities should be resumed, because until we get a vaccine that almost everybody’s had, the risk of a rebound will be there.”

As of Jan. 3, 2021, the CDC had recorded over 20 million COVID-19 cases and nearly 350,000 related deaths.

Lasting immunity after mild, asymptomatic COVID-19 infection

A study was published Dec. 24, 2020, in Science Immunology by scientists from Queen Mary, University of London, in which they analyzed antibody and T cell responses in 136 London health care workers and reported that there was evidence of protective immunity up to four months after mild or asymptomatic COVID-19.

press release issued by the university stated that mild or asymptomatic SARS-CoV-2 infections represent the largest infected group and noted that researchers found T cell responses tended to be higher in those with the classic, defining symptoms of COVID-19, while asymptomatic infection resulted in a weaker T cell immunity than symptomatic infection, but equivalent neutralizing antibody responses. One of the researchers commented:

“Our study of SARS-CoV-2 infection in healthcare workers from London hospitals reveals that four months after infection, around 90 percent of individuals have antibodies to block the virus. Even more encouragingly, in 66 percent of healthcare workers we see levels of these protective antibodies are high and that this robust antibody response is complemented by T cells which we see reacting to various parts of the virus.

“This is good news. It means that if you have been infected there is a good chance that you will have developed antibodies and T cells that may provide some protection if you encounter the virus again.”

Originally published by Mercola.

The views and opinions expressed in this article are those of the authors and do not necessarily reflect the views of Children’s Health Defense.

The Biden Crime Family


Pres Trump is most admired man in America, according to Gallup Polls – sorry Libtards: “Orange Man Bad” is minority opinion
https://www.marketwatch.com/story/donald-trump-breaks-barack-obamas-record-streak-as-americas-most-admired-man-11609254922?mod=MW_article_top_stories

Ukraine releases Documents showing the Biden Crime Family robbed Ukraine People of Millions of Dollars
Ukraine Press Conference Explicitly Ties Hunter & Joe Biden To Corruption
https://www.zerohedge.com/political/ukraine-press-conference-explicitly-ties-hunter-joe-biden-corruption

kiikolkjkfmgboaa

YouTube Press Release in Ukrainian with English Subtitles:  https://www.youtube.com/watch?v=hKDXVo-OKeQ&feature=emb_logo

New Files Released From Ukraine Reveals Biden, Obama Officials Allegedly
Got 17.5 MILLION Dollars Through Racketeering
https://thehill.com/opinion/campaign/463307-solomon-these-once-secret-memos-cast-doubt-on-joe-bidens-ukraine-story

Get Ukraine Docs on Biden from  https://www.scribd.com/user/259237201/JohnSolomon
https://rightwingtribune.com/2019/10/12/new-files-released/
https://www.foxnews.com/politics/documents-heighten-scrutiny-on-biden-ukraine-dealings-indicate-hunter-may-have-made-millions
https://www.breitbart.com/2020-election/2019/09/26/report-hundreds-of-documents-conflict-with-joe-bidens-account-of-why-ukrainian-prosecutor-was-fired/

Ukrainian Lawmaker Says Joe Biden Took $900k from Burisma While Still in Office, Claims To Have Documents Proving It
https://www.westernjournal.com/ukrainian-lawmaker-says-joe-biden-took-900k-burisma-still-office-claims-documents-proving/

The Biden Family also got massive Bribes from China

——– Forwarded Message ——–Subject:
China wired $$$ to Hunter Biden, Hunter wired some to Joe – Joe Biden will be arrested, not inaugurated
Date:  Mon, 28 Dec 2020 18:18:20 -0800
China wired $$$ to Hunter Biden, then Hunter wired $$$ to Joe – Joe Biden will be arrested, not inaugurated

jecbahoepjackhji
Hunter Biden in 2017 sent ‘best wishes’ from ‘entire Biden family’ to China firm chairman, requested $10M wire
https://www.foxnews.com/politics/hunter-biden-letter-chinese-cefc-chairman-wire-request
BIDEN TAPES REVEAL HUNTER AND JOE GUILTY OF SECRET CHINA DEALS!        https://themarshallreport.wordpress.com/2020/12/11/biden-tapes-reveal-hunter-and-joe-guilty-of-secret-china-deals/
Imposter Joe Biden must be arrested, prosecuted and incarcerated for the good of the Republic
https://www.sgtreport.com/2020/12/imposter-joe-biden-must-be-arrested-prosecuted-and-incarcerated-for-the-good-of-the-republic-2/

How Treasury Dept. tracked overseas cash pocketed by Hunter Biden
https://www.washingtontimes.com/news/2020/oct/4/how-treasury-dept-tracked-overseas-cash-pocketed-b/

Senate investigators: New records ‘confirm’ troubling Biden family links to China and Russia
https://www.washingtonexaminer.com/news/senate-investigators-new-records-confirm-troubling-biden-family-links-to-china-and-russia

The Biden Corruption Scandal Isn’t About Hunter, It’s About Joe
https://thefederalist.com/2020/10/19/the-biden-corruption-scandal-isnt-about-hunter-its-about-joe/

hgchjooijbglanhc

Hunter Biden’s addiction is not the issue. Joe Biden’s addiction is: His addiction to power and money.
And it is the evidence of the former vice president’s corruption, and the national security risk our country would face by electing Biden,
that is the story of the MacBook hard drive, not the salacious, verified photographs and videos of Hunter Biden.
Data and emails on Hunter Biden’s Laptop show everything.

And then Ukraine:

Ukraine releases Documents showing the Biden Crime Family robbed Ukraine People of Millions of Dollars
YouTube Press Release in Ukrainian with English Subtitles:  https://www.youtube.com/watch?v=hKDXVo-OKeQ&feature=emb_logo

New Files Released From Ukraine Reveals Biden, Obama Officials Allegedly
Got 17.5 MILLION Dollars Through Racketeering
https://thehill.com/opinion/campaign/463307-solomon-these-once-secret-memos-cast-doubt-on-joe-bidens-ukraine-story

Get Ukraine Docs on Biden from  https://www.scribd.com/user/259237201/JohnSolomon
https://rightwingtribune.com/2019/10/12/new-files-released/
https://www.foxnews.com/politics/documents-heighten-scrutiny-on-biden-ukraine-dealings-indicate-hunter-may-have-made-millions
https://www.breitbart.com/2020-election/2019/09/26/report-hundreds-of-documents-conflict-with-joe-bidens-account-of-why-ukrainian-prosecutor-was-fired/
Ukrainian Lawmaker Says Joe Biden Took $900k from Burisma While Still in Office, Claims To Have Documents Proving It
https://www.westernjournal.com/ukrainian-lawmaker-says-joe-biden-took-900k-burisma-still-office-claims-documents-proving/


The Biden Family also got massive Bribes from China

hitler

——– Forwarded Message ——–Subject:
PA House finds 200,000 bogus votes
Date:  Mon, 28 Dec 2020 17:26:52 -0800

PA House finds 200,000 bogus votes (next AZ, NV, WI, MI, GA)
https://hereistheevidence.com/election-2020/pa-update-records/
https://twitter.com/russdiamond/status/1343622485946880007
https://www.thegatewaypundit.com/2020/12/breaking-pennsylvania-certified-results-president-found-error-error-twice-size-difference-candidates/

After nearly two months, the state of Pennsylvania is found to have certified votes that are in error.
The Pennsylvania House has just uncovered that the certified results in Pennsylvania for President are in error by more than 200,000 votes.
This is more than twice the difference between President Trump and Joe Biden.

Stop the Steal!   https://stopthesteal.us/
Plot to Steal America Video – 17 minute Video
https://www.facebook.com/DonaldTrump/videos/219439113008326

bpgcngnphpkhekeh

Not just Corruption – actually Treason!  
Media Controls Public Opinion and even Censors the President.
Counterfeit Ballots, hacked Dominion Election-counting Software that weights votes more to Biden.
Shredded Ballots, all for Trump
—————————————————————-
Statement on Election Fraud by President Trump – 14 minute Video

https://www.facebook.com/DonaldTrump/videos/436515744393744
————————————————————————–

Watch Security Camera Videos that show the SAME Ballots stuffed into machines over and over again
https://www.thegatewaypundit.com/2020/12/president-trump-retweets-gateway-pundit-video-showing-poll-workers-stuffing-ballots-tabulators-numerous-times-election-night/
——————————————————————————–
Peter Navarro presents his report on Election Fraud
https://www.facebook.com/watch/?v=1723824047794927
36 page Navarro Report of Election Fraud in 6 States
https://www.thegatewaypundit.com/2020/12/theft-thousand-cuts-assistant-president-trump-peter-navarro-produces-report-fraud-2020-election/
https://phibetaiota.net/wp-content/uploads/2020/12/Navarro-Report-Six-Dimensions-Election-Irregularities.pdf
———————————————————————————
Summary of the Voter Fraud by OAN – 1-1/2 minutes

————————————————————————————–
Stop The Steal – 1 minute Video

https://www.facebook.com/DonaldTrump/videos/238598167675214
—————————————————————————————-
Georgia Poll Worker details the Fraud he saw – 2 minute Video

https://www.facebook.com/DonaldTrump/videos/230560558543713
—————————————————————————————
Fight for Trump – Save America, Save the World – 2 minute Video
https://www.facebook.com/153080620724/videos/2849119275359249

migcfghhfiefehin

How to Steal an Election – 1 minute Video
https://streamable.com/8cdi3o
A powerful video laying out the globalist plot to steal the 2020 presidential election starting with the release of the China Virus
went viral over the weekend after President Trump shared it on Twitter.
Twitter suspended the account of @CJTruth, the user who shared the video shortly after President Trump had retweeted it on Sunday.
https://banned.video/watch?id=5fdfdb96222e2d0828f87784

imcmhhbgkfcgpcmc

Dominion software deleted over 2.7 million votes nationwide, switched over 500,000 from Trump to Biden

https://www.naturalnews.com/2020-11-12-trump-bombshell-dominion-software-deleted-votes-switched-biden.html

ohmepboibgeebcjm

Watch Security Camera Videos that show the SAME Ballots stuffed into machines over and over again
https://www.thegatewaypundit.com/2020/12/president-trump-retweets-gateway-pundit-video-showing-poll-workers-stuffing-ballots-tabulators-numerous-times-election-night/
More on Trump’s WINs in Court and with State Legislatures
Listen to President Trump’s latest 6 minute speech
https://www.facebook.com/DonaldTrump/videos/436515744393744/?t=10

Will TRUMP be the NEXT LINCOLN?? Will TRUMP smash the DEEP STATE COUP??
1) Election Vote FRAUD is proven in many States
36 page Navarro Report of Election Fraud in 6 States
https://www.thegatewaypundit.com/2020/12/theft-thousand-cuts-assistant-president-trump-peter-navarro-produces-report-fraud-2020-election/
https://phibetaiota.net/wp-content/uploads/2020/12/Navarro-Report-Six-Dimensions-Election-Irregularities.pdf
 

6) Lawsuits continue in many States and Supreme Court
7) Some State Legislatures may overturn Fraudulent Election in their State (like PA now)

I can’t be the only one with problems with the added pork!


https://www.zerohedge.com/political/pork-city-here-are-most-ridiculous-pet-projects-900-billion-spending-package

Pork City: Here Are The Most Ridiculous Pet Projects In $900 Billion Stimulus Package

Tyler Durden's Photo
by Tyler Durden
Monday, Dec 21, 2020 – 17:40

As Congress prepares to pass a $900 billion COVID-19 stimulus bill rolled into a consolidated appropriations package – with funding for assistance for households and businesses, along with vaccine distribution and other pandemic-related measures, the bill also includes a ton of pork per usual.

Illustration via WSJ.com

https://www.zerohedge.com/political/pork-city-here-are-most-ridiculous-pet-projects-900-billion-spending-package
Pet Pork Projects in the $900 Billion Stimulus Package:
(What do these Pork Projects have to do with Covid Help???)
($50 Billion? in Ridiculous Pet Projects added to Covid Help Bill )
$453 Million to Ukraine
$10 Million for Gender Programs in Pakistan
$3.3 Billion to Israel
$1.3 Billion to Egypt
$700 Million to Sudan
$130 Million to Nepal
$135 Million to Burma
$85.5 Million to Cambodia
$1.4 Billion for Asia Reassurance
$4 Billion for Navy Weapons
$2 Billion for Space Force
$2 Billion for Air Force Missiles
$208 Million to upgrade Census Bureau computers to prep for 2030
$40 Million for the Kennedy Center
$193 Million for HIV/AIDS workers to buy cars and a museum

IF WE HAD 10 OF YOU WE’D RULE THE WORLD: BIDEN TO STACEY ABRAMS (VIDEO) — ARLIN REPORT……………….walking this path together

Originally posted on Burst Updates: Biden spoke at Georgia’s senate runoff campaign yesterday: “Stacey if we had 10 of you we could rule the whole world. God love ya. If you want to do the bidding of Texas, you should be running in Texas.” The dem goal is to beat GOP candidates Loeffler and Perdue…

IF WE HAD 10 OF YOU WE’D RULE THE WORLD: BIDEN TO STACEY ABRAMS (VIDEO) — ARLIN REPORT……………….walking this path together

Driving in the State of Florida

New Zealand Has Quatantine Camps. We Should Be Very Careful!

12/04/20

Mary + Polly Discuss AstraZeneca Vaccine Trial Volunteer, New Zealand ‘Quarantine Camps’ and More

In “This Week” with Mary Holland, Children’s Health Defense vice chair and general counsel, and Polly Tommey, co-producer of “Vaxxed,” Mary and Polly discuss the AstraZeneca vaccine trial participant who says he was injured, New Zealand “quarantine camps” … and more.

Mary + Polly Discuss AstraZeneca Vaccine Trial Volunteer, New Zealand ‘Quarantine Camps’ and More

Conversation-at-a-Glance

  • A participant in India’s AstraZeneca COVID vaccine trials reported to the Serum Institute, which is sponsoring the trial, that he developed acute neuro encephalopathy (a condition similar to what autistic children experience) after receiving the vaccine. “We should be very concerned about the tremendous levels of adverse events in all the COVID vaccine trials, and the obfuscation around who was in the trials.”
  • New Zealand is creating “quarantine camps” where people who test positive for COVID are held against their will until they test negative. “It’s extraordinary that a common law country like New Zealand is leading the charge in these draconian measures.”
  • In Portugal, the court ruled it illegal to force four German tourists into quarantine on the basis of a PCR test — which can give up to 97% false positives. Finland says it will not test healthy people, because there’s too much risk of false positives.
  • Brazil’s president, Jair Bolsonaro, said he will refuse the COVID vaccine. “Good for him, it’s an individual’s right anywhere to refuse unwanted medical intervention, and it’s the law here in the U.S.”
  • Employers can legally mandate the flu vaccine as a measure to prevent employees from getting COVID, but look for this issue to get more contentious. Some employers will also try to mandate COVID vaccines, “but I think legal cases against COVID vaccine mandates will succeed.”
  • Celebrities are being recruited to counter “anti-vaxxers” and guilt people into getting the vaccine “for the common good, for your mother, for your grandmother.” But we’ll have celebrities on our side, too, and they’ll talk about the potential for injuries without liability, and how for vaccine makers and others, “there are trillions of dollars at stake.”
  • In the UK, the British army says it will deploy its information warfare unit against “anti-vax propaganda.” But typically when a country starts deploying the military against its own citizens, “it doesn’t work for very long.”
  • Some good news last week: The Supreme Court said New York can’t restrict the number of people allowed to gather in churches and synagogues. The court ruled that the government can’t use a crisis to overrule the First Amendment.
  • There’s still time to contact the District of Columbia’s mayor and ask her to veto a bill, passed by Nov. 17 by the district’s city council that would allow children 11 and older to get a vaccine without parental consent. If this bill passes, Big Pharma will try to push it through all over the country. Even if you don’t live in D.C. please contact Mayor Bower. Go here for details.

Bill Gates Really Did Say It!

Yes, Bill Gates Said That. Here’s the Proof.

Gates and his minions insist the billionaire never said we’d need digital vaccine passports. But in a June 2020 TED Talk, Gates said exactly that. Someone edited out the statement, but CHD tracked down the original.

Yes, Bill Gates Said That. Here’s the Proof.

Some chiseler altered Bill Gates’ June 2020 TED Talk to edit out his revealing prediction that we will all soon need digital vaccine passports (slide 1). But after considerable effort, we tracked down the original video (slide 2).

Gates’ minions on cable and network news, his public broadcasting, social media and fact-checker toadies all now insist that Gates never said such things. They say he never intended to track and trace us with subdermal chips or injected tattoos.

They dismiss such talk as “conspiracy theories.”

Well, here it is from the horse’s mouth.

In 2019, according to a not-yet-purged Scientific American article, Gates commissioned the Massachusetts Institute of Technology to build an injectable quantum dot dye system to tattoo stored medical info beneath children’s skin. The tattoo was designed to be readable by an iPhone app.

Gates’ company, Microsoft, has patented a sinister technology that uses implanted chips with sensors that will monitor body and brain activity. It promises to reward compliant humans with crypto currency payments when they perform assigned activities.

Gates also invested approximately $20 million in MicroCHIPS, a company that makes chip-based devices, including birth-control implant chips with wireless on/off switches for remote-controlled drug-delivery by medical authorities.

In July 2019, months before the COVID pandemic, Gates bought 3.7M shares of Serco, a military contractor with U.S. and UK government contracts to track and trace pandemic infections and vaccine compliance.

To facilitate our transition to his surveillance society, Gates invested $1 billion in EarthNow, which promises to blanket the globe in 5G video surveillance satellites. EarthNow will launch 500 satellites allowing governments and large enterprises to live-stream monitor almost every “corner” of the Earth, providing instantaneous video feedback with one-second delay.

The Bill and Melinda Gates Foundation also acquired 5.3 million shares of Crown Castle, which owns 5G spy antennas including more than 40,000 cell towers and 65,000 small cells.

Please make your own copy of these clips — as Gates’ power to disappear inconvenient facts is expanding every digital day.

DEKALB COUNTY GA COVID-19

Image
https://www.dekalbhealth.net/covid-19/
The Georgia Department of Public Health (DPH) is closely monitoring an outbreak of respiratory illness caused by a novel (new) coronavirus (COVID-19) first identified in Wuhan, Hubei Province, China in December 2019, and regularly coordinating with the Centers for Disease Control and Prevention (CDC). The outbreak continues to grow in China and cases have been identified in a growing number of other international locations, including the United States.
Please review the resources and links below for information on COVID-19.


COVID-19 TESTING SITES IN DEKALB COUNTY


TESTING SITE
LOCATION
HOURS OF OPERATION
BrandsMart USA Parking Lot


Make an Appointment in English
Registro en Español
or call (404) 294-3700 Option 1 for an appointment
5000 Motors Industrial Way
Atlanta, Ga. 30360
Monday – Friday: 8:00 a.m. – 6:00 p.m.
Saturday: Closed
Sunday: Closed

*Thanksgiving Holiday Testing Hours*
November 25: 8 a.m. – 2 p.m.
November 26 – November 28: Closed


Former Sam’s Club Parking Lot


Make an Appointment in English
Registro en Español
or call (404) 294-3700 Option 1 for an appointment
2994 Turner Hill Rd
Stonecrest, Ga. 30038
Monday – Friday: 9:00 a.m. – 4:00 p.m.
Saturday: 9:00 a.m. – 12:00 p.m.
Sunday: Closed

*Thanksgiving Holiday Testing Hours*
November 25: 8 a.m. – 2 p.m.
November 26 – November 27: Closed
November 28: 9 a.m. – 12 noon
Greater Piney Grove Baptist Church


Make an Appointment in English
Registro en Español
or call (404) 294-3700 Option 1 for an appointment
1879 Glenwood Ave. SE
Atlanta, Ga. 30316
Monday – Friday: 10:00 a.m. – 3:00 p.m.
Saturday: Closed
Sunday: Closed

*Thanksgiving Holiday Testing Hours*
November 25: 8 a.m. – 2 p.m.
November 26 – November 28: Closed



COVID-19 TESTING
Use our online form to schedule an appointment for COVID-19 testing

COVID-19 CALL CENTER
Have COVID-19 questions? Call our call center to get answers

DEKALB COUNTY COVID-19 CASES
See the latest information on COVID-19 cases by zip code in DeKalb County

ESSENTIAL SERVICES
See what essential services are provided during the COVID-19 pandemic
Register Online
Call
View Cases
View Services

GOVERNOR’S OFFICE
View the latest Executive Orders

2020 Govenor’s Executive Orders

EXPANDED COVID-19 TESTING
View the latest information on expanded COVID-19 testing in Georgia and find your county’s direct patient line
Expanding COVID-19 Testing in GeorgiaCOVID-19 Testing – Direct Patient Lines

GEORGIA DEPARTMENT OF PUBLIC HEALTH COVID-19 INFORMATION
View the latest COVID-19 information and status report for Georgia
GA-DPH COVID-19 InformationGA COVID-19 Daily Status Report

CDC COVID-19 INFORMATION
Get the latest COVID-19 tips and resources from the CDC

CDC COVID-19 Information

ENVIRONMENTAL PROTECTION AGENCY (EPA) COVID-19 INFORMATION
View information on disinfectants that will work against COVID-19

EPA COVID-19 Information

COVID-19 RESTAURANT GUIDANCE
Restaurant Owner: View these important operation guidelines for COVID-19
COVID-19 Guidance for Restaurants

PRINT RESOURCES FOR COVID-19
View, print and share helpful resources and information regarding the Novel Coronavirus

COVID-19 Print Resources

COVID-19 VIDEO RESOURCES










HOAX

British Intelligence is a major part of Deep State Coup against Trump

Meet Lord Malloch Brown: The British Hand Behind The Coup To Oust Trump

https://www.zerohedge.com/geopolitical/meet-lord-malloch-brown-british-hand-behind-coup-oust-trump

From the obvious role of Sir Richard Dearlove and his former MI6 underlying Christopher Steele who together played a driving role in shaping the dodgy dossier,
to their involvement with Oxford Rhodes Scholar Strobe Talbott in composing, promoting and marketing the fraudulent dossier to targeted members of Congress and media,
to British Ambassador Sir Darroch caught “flooding the zone” with British intelligence assets to shape Trump’s perception of the world,
to the array of British entrapment operations that targeted Michael Flynn as early as 2014 in London
… wherever one looks, the hand of British intelligence seems to be everywhere.
———————————————
Is Lord Malloch’s name tied to the Canaanite god “Moloch”
that is worshipped by the Elite in Bohemian Grove with child sacrifices?
(In semitic languages, the vowels in a word are changed for variations – the core consonants are the basic part of the word.
https://en.wikipedia.org/wiki/Semitic_languages
For example, in Arabic, the root meaning “write” has the form k-t-b. From this root, words are formed by filling in the vowels and sometimes adding additional consonants,
e.g. كتاب kitāb “book”, كتب kutub “books”, كاتب kātib “writer”, كتّاب kuttāb “writers”, كتب kataba “he wrote”, يكتب yaktubu “he writes”, etc.)
Bohemian Grove

Continue reading “HOAX”

RedPill University: The Emperor Has No Clothes, and There is No Virus!

The Emperor Has no Clothes – and There is no Virus

4.9
(65)

David Icke Dares to say what many of us have suspected but were hesitant to speak publicly lest we be thought insane. Everyone by now is aware that the official narrative of COVID-19 is loaded with contradictions and fraud, but if the underlying concept, itself – the assertion that a deadly virus is stalking the human race – is not true, then we are facing something far more serious than bad science, poor judgement, and profiteering. If the contradictions and fraud are necessary to perpetuate a grand deception, then our response changes drastically. It changes because we no longer are engaged in a debate over the best way to cope with a global pandemic but in resisting a propaganda campaign to maneuver us into passively accepting a new normal of servitude to a global technocratic dictatorship. For the record, we think David is 100% correct.  2020 November 12 – Source: David Icke

RETURN TO HOME PAGE 

You can view this video from several sources. Cached versions are adjusted for optimum quality, if needed, and they provide access if original sources fail.

Blaylock: Face Masks Pose Serious Risks To The Healthy

Image credit: engin akyurt on Unsplash

Blaylock: Face Masks Pose Serious Risks To The Healthy

image_pdfimage_print
Dr. Russell Blaylock warns that not only do face masks fail to protect the healthy from getting sick, but they also create serious health risks to the wearer. The bottom line is that if you are not sick, you should not wear a face mask.As businesses reopen, many are requiring shoppers and employees to wear a face mask. Costco, for instance, will not allow shoppers into the store without wearing a face mask. Many employers are requiring all employees to wear a face mask while at work. In some jurisdictions, all citizens must wear a face mask if they are outside of their own home.  ⁃ TN Editor

With the advent of the so-called COVID-19 pandemic, we have seen a number of medical practices that have little or no scientific support as regards reducing the spread of this infection. One of these measures is the wearing of facial masks, either a surgical-type mask, bandana or N95 respirator mask. When this pandemic began and we knew little about the virus itself or its epidemiologic behavior, it was assumed that it would behave, in terms of spread among communities, like other respiratory viruses. Little has presented itself after intense study of this virus and its behavior to change this perception.

This is somewhat of an unusual virus in that for the vast majority of people infected by the virus, one experiences either no illness (asymptomatic) or very little sickness. Only a very small number of people are at risk of a potentially serious outcome from the infection—mainly those with underlying serious medical conditions in conjunction with advanced age and frailty, those with immune compromising conditions and nursing home patients near the end of their lives. There is growing evidence that the treatment protocol issued to treating doctors by the Center for Disease Control and Prevention (CDC), mainly intubation and use of a ventilator (respirator), may have contributed significantly to the high death rate in these select individuals.

By wearing a mask, the exhaled viruses will not be able to escape and will concentrate in the nasal passages, enter the olfactory nerves and travel into the brain.

Russell Blaylock, MD

As for the scientific support for the use of face mask, a recent careful examination of the literature, in which 17 of the best studies were analyzed, concluded that, “ None of the studies established a conclusive relationship between mask/respirator use and protection against influenza infection.”1   Keep in mind, no studies have been done to demonstrate that either a cloth mask or the N95 mask has any effect on transmission of the COVID-19 virus. Any recommendations, therefore, have to be based on studies of influenza virus transmission. And, as you have seen, there is no conclusive evidence of their efficiency in controlling flu virus transmission.

It is also instructive to know that until recently, the CDC did not recommend wearing a face mask or covering of any kind, unless a person was known to be infected, that is, until recently. Non-infected people need not wear a mask. When a person has TB we have them wear a mask, not the entire community of non-infected. The recommendations by the CDC and the WHO are not based on any studies of this virus and have never been used to contain any other virus pandemic or epidemic in history.

Now that we have established that there is no scientific evidence necessitating the wearing of a face mask for prevention, are there dangers to wearing a face mask, especially for long periods? Several studies have indeed found significant problems with wearing such a mask. This can vary from headaches, to increased airway resistance, carbon dioxide accumulation, to hypoxia, all the way to serious life-threatening complications.

There is a difference between the N95 respirator mask and the surgical mask (cloth or paper mask) in terms of side effects. The N95 mask, which filters out 95% of particles with a median diameter >0.3 µm2 , because it impairs respiratory exchange (breathing) to a greater degree than a soft mask, and is more often associated with headaches. In one such study, researchers surveyed 212 healthcare workers (47 males and 165 females) asking about presence of headaches with N95 mask use, duration of the headaches, type of headaches and if the person had preexisting headaches.2

How is Coronavirus Getting Into the Brain?

Vaccine Reaction

They found that about a third of the workers developed headaches with use of the mask, most had preexisting headaches that were worsened by the mask wearing, and 60% required pain medications for relief. As to the cause of the headaches, while straps and pressure from the mask could be causative, the bulk of the evidence points toward hypoxia and/or hypercapnia as the cause. That is, a reduction in blood oxygenation (hypoxia) or an elevation in blood C02 (hypercapnia). It is known that the N95 mask, if worn for hours, can reduce blood oxygenation as much as 20%, which can lead to a loss of consciousness, as happened to the hapless fellow driving around alone in his car wearing an N95 mask, causing him to pass out, and to crash his car and sustain injuries. I am sure that we have several cases of elderly individuals or any person with poor lung function passing out, hitting their head. This, of course, can lead to death.

A more recent study involving 159 healthcare workers aged 21 to 35 years of age found that 81% developed headaches from wearing a face mask.3   Some had pre-existing headaches that were precipitated by the masks. All felt like the headaches affected their work performance.

Unfortunately, no one is telling the frail elderly and those with lung diseases, such as COPD, emphysema or pulmonary fibrosis, of these dangers when wearing a facial mask of any kind—which can cause a severe worsening of lung function. This also includes lung cancer patients and people having had lung surgery, especially with partial resection or even the removal of a whole lung.

While most agree that the N95 mask can cause significant hypoxia and hypercapnia, another study of surgical masks found significant reductions in blood oxygen as well. In this study, researchers examined the blood oxygen levels in 53 surgeons using an oximeter. They measured blood oxygenation before surgery as well as at the end of surgeries.4 The researchers found that the mask reduced the blood oxygen levels (pa02) significantly. The longer the duration of wearing the mask, the greater the fall in blood oxygen levels.

The importance of these findings is that a drop in oxygen levels (hypoxia) is associated with an impairment in immunity. Studies have shown that hypoxia can inhibit the type of main immune cells used to fight viral infections called the CD4+ T-lymphocyte. This occurs because the hypoxia increases the level of a compound called hypoxia inducible factor-1 (HIF-1), which inhibits T-lymphocytes and stimulates a powerful immune inhibitor cell called the Tregs. . This sets the stage for contracting any infection, including COVID-19 and making the consequences of that infection much graver. In essence, your mask may very well put you at an increased risk of infections and if so, having a much worse outcome.5,6,7

People with cancer, especially if the cancer has spread, will be at a further risk from prolonged hypoxia as the cancer grows best in a microenvironment that is low in oxygen. Low oxygen also promotes inflammation which can promote the growth, invasion and spread of cancers.8,9  Repeated episodes of hypoxia has been proposed as a significant factor in atherosclerosis and hence increases all cardiovascular (heart attacks) and cerebrovascular (strokes) diseases.10

There is another danger to wearing these masks on a daily basis, especially if worn for several hours. When a person is infected with a respiratory virus, they will expel some of the virus with each breath. If they are wearing a mask, especially an N95 mask or other tightly fitting mask, they will be constantly rebreathing the viruses, raising the concentration of the virus in the lungs and the nasal passages. We know that people who have the worst reactions to the coronavirus have the highest concentrations of the virus early on. And this leads to the deadly cytokine storm in a selected number.

It gets even more frightening. Newer evidence suggests that in some cases the virus can enter the brain.11,12 In most instances it enters the brain by way of the olfactory nerves (smell nerves), which connect directly with the area of the brain dealing with recent memory and memory consolidation. By wearing a mask, the exhaled viruses will not be able to escape and will concentrate in the nasal passages, enter the olfactory nerves and travel into the brain.13

It is evident from this review that there is insufficient evidence that wearing a mask of any kind can have a significant impact in preventing the spread of this virus. The fact that this virus is a relatively benign infection for the vast majority of the population and that most of the at-risk group also survive, from an infectious disease and epidemiological standpoint, by letting the virus spread through the healthier population we will reach a herd immunity level rather quickly that will end this pandemic quickly and prevent a return next winter. During this time, we need to protect the at-risk population by avoiding close contact, boosting their immunity with compounds that boost cellular immunity and in general, care for them.

One should not attack and insult those who have chosen not to wear a mask, as these studies suggest that is the wise choice to make.

References

  1. bin-Reza F et al. The use of mask and respirators to prevent transmission of influenza: A systematic review of the scientific evidence. Resp Viruses 2012;6(4):257-67.
  2. Zhu JH et al. Effects of long-duration wearing of N95 respirator and surgical facemask: a pilot study. J Lung Pulm Resp Res 2014:4:97-100.
  3. Ong JJY et al. Headaches associated with personal protective equipment- A cross-sectional study among frontline healthcare workers during COVID-19. Headache 2020;60(5):864-877.
  4. Bader A et al. Preliminary report on surgical mask induced deoxygenation during major surgery. Neurocirugia 2008;19:12-126.
  5. Shehade H et al. Cutting edge: Hypoxia-Inducible Factor-1 negatively regulates Th1 function. J Immunol 2015;195:1372-1376.
  6. Westendorf AM et al. Hypoxia enhances immunosuppression by inhibiting CD4+ effector T cell function and promoting Treg activity. Cell Physiol Biochem 2017;41:1271-84.
  7. Sceneay J et al. Hypoxia-driven immunosuppression contributes to the pre-metastatic niche. Oncoimmunology 2013;2:1 e22355.
  8. Blaylock RL. Immunoexcitatory mechanisms in glioma proliferation, invasion and occasional metastasis. Surg Neurol Inter 2013;4:15.
  9. Aggarwal BB. Nucler factor-kappaB: The enemy within. Cancer Cell 2004;6:203-208.
  10. Savransky V et al. Chronic intermittent hypoxia induces atherosclerosis. Am J Resp Crit Care Med 2007;175:1290-1297.
  11. Baig AM et al. Evidence of the COVID-19 virus targeting the CNS: Tissue distribution, host-virus interaction, and proposed neurotropic mechanisms. ACS Chem Neurosci 2020;11:7:995-998.
  12. Wu Y et al. Nervous system involvement after infection with COVID-19 and other coronaviruses. Brain Behavior, and Immunity, In press.
  13. Perlman S et al. Spread of a neurotropic murine coronavirus into the CNS via the trigeminal and olfactory nerves. Virology 1989;170:556-560.

Dr. Russell Blaylock, author of The Blaylock Wellness Report newsletter, is a nationally recognized board-certified neurosurgeon, health practitioner, author, and lecturer. He attended the Louisiana State University School of Medicine and completed his internship and neurological residency at the Medical University of South Carolina. For 26 years, practiced neurosurgery in addition to having a nutritional practice. He recently retired from his neurosurgical duties to devote his full attention to nutritional research. Dr. Blaylock has authored four books, Excitotoxins: The Taste That KillsHealth and Nutrition Secrets That Can Save Your LifeNatural Strategies for Cancer Patients, and his most recent work, Cellular and Molecular Biology of Autism Spectrum Disorders.

Do I Need Say More??? Quit Drinking Fluoridated Water and Watching the TV News! You Will Wake Up a Communist Being Tortured

A Must Read! Cease and Desist Your Mandatory Mask Policy by Jason Hommel

CEASE AND DESIST YOUR MANDATORY MASK POLICY

Jason Hommel
(530) 559 2974

 

CEASE AND DESIST YOUR MANDATORY MASK POLICY

On 7-31-2020, just before 1:30pm in the afternoon, my wife and I were asked to leave the Sprouts Store located on 82nd and Quaker, in Lubbock, TX, because they specifically said they do not recognize medical exemptions to wearing masks. We were wearing medical exemption badges, which are not required by law to be worn, to help inform others. I was given a store policy sheet, and I was invited to shop online, from home.

I hereby demand that you cease and desist requiring wearing masks to shop at your stores owned and operated by Sprouts Farmers Market, Inc.

I hereby demand that you stop violating the law in numerous ways, as follows.

  1. You are in violation of both the City of Lubbock and the State of Texas masking laws, both of which make provisions for medical exemptions. You are not allowing medical exemptions, in violation of both laws, laws which you are fraudulently attempting to enforce.

1A. You are not a police officer. You are not empowered to enforce laws.

  1. You are practicing medicine without a licence, which illegal in all States in America, which is a felony, and carries with it a prison term from 1 to 8 years. A mask to prevent viral transmission is a medical intervetion that carries with it risks, such as reduced oxygen intake, increased CO2 intake, increased risk of viral and bacterial and fungal lung infections, fungal face infections, and potential brain damage from reduced oxygen. A list of up to 131 scientific articles and reasons to avoid wearing a mask can be found online at https://revealingfraud.com/2020/05/health/refuse/ You are overriding both the science, the law, and other doctor’s orders, in overriding the legal medical exemptions, without a medical license, in violation of numerous laws. When engaged in practicing medicine without a licence, you can be sued for damages that your advice might cause, there not need be any actual damages. You can be sued for “possible brain damage” that often carries rewards exceeding $1-10 million dollars in damages, and you can be held personally and corporately liable. I hereby again claim my own medical exemption, and I’m not required by law to tell you my medical history, nor are you allowed to ask, because of medical privacy laws protected by HIPAA. But my medical history is published online at revealingfraud.com anyway.

2.(A) Medical Professionals can only “prescribe” medical procedures, which means to give advice. They are not even legally allowed to mandate a medical procedure. In order for Doctors to mandate a medical procedure, they first need to either obtain a medical power of attorney document over a patient, and/or declare the person unconscious and/or unfit to decline a life saving procedure. You neither have a medial power of attorney over me, nor have I hired you to be my doctor, nor am I unconscious. Nor am I mentally compromised in any way. By wearing a mask, you restrict your own oxygen, and you mentally compromise yourself. You might want to take off your mask, and take a few deep breaths to get oxygen to your brain, to help you understand the rest of this.

  1. You are violating the ADA Act, the Americans with Disabilities Act, that requires that you make reasonable accommodation to those with disabilities that could include numerous medical disabilities that could prevent people from wearing masks, such as, but not limited to, the following: asthma, allergies, anemia, fungal infections, blood clotting disorders, diabetes, PTSD, autism, pre existing lung problems, “being a human”, and needing to meet basic OSHA air quality requirements of more then 19.5% oxygen, and less then 400 parts per million CO2. Masks have been shown to reduce oxygen to 18% and increase CO2 to over 10,000 ppm.

3.(A) To help you understand the level of offense of your illegal discrimination, try demanding that black people not enter your store on the basis that give off particles that are offensive, and requiring them to shop at home. That is as offensive as refusing service to those not wearing masks for reasons of a medical exemption. The ADA also requires you to make reasonable accommodations for people with a religious exemption to wearing masks, because discrimination based on religion is also illegal.

  1. Your demand that customers wear masks, with no medical exemptions, fraudulently assumes that masks work. They do not. Air easily slips around all masks, such as the very large air gaps around the nose, cheeks and chin. Furthermore, the particle size of the coronavirus is typically 1/1000th of the size of the spacing between threads of the mask itself. A coronavirus is 0.1 microns. Holes in cloth masks are up to 100 microns. If you “zoom in” this is like expecting two threads, spaced as far apart as three football fields, 900 feet, to filter out a shoe the size of one foot. That is insane. Furthermore, there are 1000 microns per millimeter. The air gaps around the mask, by the nose, if they are half a centimeter, are 5000 microns. A coronavirus is 0.1 microns. The difference is 50,000 times in size. This gap is so big, and the virus is so small, it’s like two lines, 10 miles apart, (52,800 feet) trying to filter out a basketball (just under a foot). Mask wearing is mental insanity. In both theory and actual fact, masks cannot possibly work to do what you expect them to do, so your position is not based on science, but rather, irrational fear, and irrational expectations that masks work, when they cannot. Since your position is based on insanity and the fraud that masks work, it cannot be said to follow the law and be “reasonable”. Furthermore, restaurants are open, with up to 60-100 people eating at once, with nobody wearing a mask while eating, and that fully complies with the law. So how could one person not wearing a mask in a grocery store be a danger compared to that? Fraud also carries with it a prison sentence, as fraud is a felony.
  2. When informed that mandatory masking was a fraud, and therefore a felony, the Orange County board of Supervisors abandoned their mandatory mask policy, back on June 9th, 2020. https://www.thehealthyamerican.org/
  3. The COVID19 scare is a fraud, from top to bottom. Politicians and the Media are immune from the consequences of lying, but commercial stores have no such immunity from practicing fraud. COVID19 is fraud for the following reasons.

A. The test kits do not work. The tests have a 50% to 80% false positive rate.

B. The rate of positives has always been about 10%, from the very beginning of the crisis. The rate of people testing positive has not gone up, they have only increased the number and rate of tests given.

C. The test kits have been reported to be contaminated. June 23, 2020: https://www.webmd.com/lung/news/20200623/early-cdc-covid-19-test-kits-likely-contaminated Unswabbed swabs are reported to test positive.

Nurses’ Lawsuit Claims ‘Fabricated’ COVID-19 Tests at Georgia Hospital
Max Blau June 22, 2020 https://www.medscape.com/viewarticle/932722

D. While “confirmed case” counts have been going up, there is no such thing as a “confirmed case” because the test kits say directly on them “not to be used for diagnostic purposes” and therefore a fraudulent test with a high false positive rate cannot “confirm” anything.

  1. To determine the lethality of any disease, they need to compare cases to deaths. Both numbers suffer from massive fraud. Regarding death counts:

A. The death counts are overinflated, as States have been directed by the CDC to include presumptive or presumed cases that would not even include the fraudulent test kit non confirmation, which, itself, over counts things with that false positive rate of from 50% to 80%. “COVID-19 should be reported on the death certificate for all decedents where the disease caused or is assumed to have caused or contributed to death.” https://www.cdc.gov/nchs/data/nvss/coronavirus/Alert-2-New-ICD-code-introduced-for-COVID-19-deaths.pdf

Furthermore, Birx says government is classifying all coronavirus death cases as COVID19 caused deaths, regardless of the cause, such as underlying health issues. See point B for further corroboration. https://www.foxnews.com/politics/birx-says-government-is-classifying-all-deaths-of-patients-with-coronavirus-as-covid-19-deaths-regardless-of-cause

B. Other nations have determined that 99% of their “died with COVID” cases did not die “from COVID” as 99% of other patients were elderly and had from 1-4 other co-morbid chronic conditions. If that is true, it takes the real death rate down to nearly nothing. This was reported by Bloomberg, back on March 18th, which basically shows and admits that this is all a media hoax. https://www.bloomberg.com/news/articles/2020-03-18/99-of-those-who-died-from-virus-had-other-illness-italy-says

C. The real death counts are not higher than the rate of normal rates of pnumonia. People vastly overestimate their chances of “catching” COVID, and vastly overestimate their chances of death, with younger people, aged 18-34 giving the highest estimations, at 90% estimated chances of catching it, and a 20% chance of death if they do catch it. https://www.nber.org/papers/w27494.pdf see chart on p. 12. These estimates would have COVID killing about 328 million x .9 x .2 = 59 million Americans. Even the White House estimations of the deaths of 2 million Americans were vastly over exaggerated, and the man responsible for that model resigned in disgrace. The “official” death toll, which is grossly over exaggerated, for multiple reasons, as I am going over, stands at 137,922, per the CDC as of July 31: https://www.cdc.gov/nchs/nvss/vsrr/covid19/index.htm see Table 1. That is a total death rate of the population of 0.04%, which is substantially lower than the CDC’s latest death rate estimate last month of 0.26%. Typical flu deaths in a year vary from 50,000 to 80,000.

D. Death counts are inflated from putting people into a very risky coma plus a ventilator, and that process kills people from 88% to 90% of the time. https://ktla.com/news/nationworld/nearly-90-of-covid-19-patients-put-on-ventilators-in-new-yorks-largest-health-system-died-study-finds/

E. The real death rate could well be 137,922 x 1% (no comorbidities) x 50% due to false positives, which would be 689! Given that there is no higher overall death rate than normal, the risk from a fraudulent disease that is not increasing the total death rate is zero. A real pandemic would not require fraudulently overstating things at all levels, from test kits that don’t work, to fraudulently claiming an increase in the infected, to inflated death counts, to masks that don’t work.

F. The false pandemic is a “live exercise” planned in advance, in October 18th, 2019. https://www.centerforhealthsecurity.org/event201/

  1. People with honor do not practice nor support games of fraud. If managers wish to stop participating in the COVID media lies, they may wish to remind their employer of the Civil Rights Act of 1964 which makes it illegal to discriminate based on religious beliefs. Sections 703 A(1)(2). My own religious beliefs also prohibit me from participating in fraud, or from lying in any way.
  2. Managers of businesses cannot be hired to break the law. You may have been told by a supervisor to “enforce store policy”, but you cannot be hired to break the law nor be hired to commit one felony, let alone multiple felonies. You always have the right to tell your supervisor, “You cannot legally require me to break the law.” You may wish to present this letter to your immediate supervisors and/or human resources department, and/or legal department and/or corporate board and/or company owners.
  3. Even if you were a doctor, and a lawyer, and a police officer, you would still not have the right to demand that free people wear masks to shop at your store.
  4. Even if you petitioned congress to change all the laws above, you would still not have the right to trample on people’s Constitutional rights, and it would remain unwise to do so.
  5. Numerous “emergency COVID orders” have already been struck down as un-Constitutional in various other states.
  6. Several other large retailers in Lubbock, at their corporate level, such as Market Street United Supermarkets and Wal-Mart, have decided to honor medical exemptions to mask wearing, presumably because they have been informed of the legal issues involved, or maybe because they are already involved in litigation over it, and are engaged in actions designed to settle the disputes.
  7. After having been informed of the law, such as through a cease and desist letter like this one, if you continue to violate the law, it will be presumed that you are “willfully” violating the law, which often carries with it additional penalties, such as double the criminal prison sentence to be served, and/or double the civil fines to be paid.

Sincerely,

Jason Hommel

Post navigation

You know my response.  It would take one of the masks below, to protect you from a deadly disease spreading.  The stupid little masks that people wear, does not even cover their eyes. 
Is common sense so lacking for people?
 
Damn it sheeple wake up, you act like idiots.

fullfacemasks

Before you vote let this sink in — Jim Campbell’s

By Jim Campbell Aug. 28th 2030 Predictably it did, President Trumps Executive Order helped greatly No one who lived through the progressive reign of Dr. Do Little will forget this. They haven’t changed today. A vote for Biden is a one way ticket to the socialist state. The trains only run in one direction, but […]

Before you vote let this sink in — Jim Campbell’s

Censoring HCQ, Zithromax and the Cure For Covid By Kelleigh Nelson|July 31st, 2020

kelleigh-nelson-nwv-96x96
Kelleigh Nelson has been researching the Christian right and their connections to the left, the new age, and cults since 1975. Formerly an executive producer for three different national radio talk show hosts, she was adept at finding and scheduling a variety of wonderful guests for her radio hosts. She has owned her own wholesale commercial bakery since 1990. Previously, Kelleigh was marketing communications and advertising manager for a fortune 100 company. Born and raised in Chicago, Illinois, she was a Goldwater girl with high school classmate, Hillary Rodham, in Park Ridge, Illinois. Kelleigh is well acquainted with Chicago politics and was working in downtown Chicago during the 1968 Democratic convention riots. Email: Proverbs133@bellsouth.net


Censoring HCQ, Zithromax and the Cure For Covid

By Kelleigh Nelson|July 31st, 2020
Kelleigh Nelson

Censoring HCQ, Zithromax and the Cure For Covid

The Communists’ chief purpose is to destroy every form of independence—independent work, independent action, independent property, independent thought, an independent mind, or an independent man. Conformity, alikeness, servility, submission and obedience are necessary to establish a Communist slave-state. —Ayn Rand

Censorship reflects society’s lack of confidence in itself. It is a hallmark of an authoritarian regime. —Potter Stewart, Supreme Court Justice

Free speech is the whole thing, the whole ball game. Free speech is life itself. —Salman Rushdie

Quite obviously, Hillary loving Dr. Anthony Fauci would prefer to make beaucoup bucks on his Remdesivir which is unproven to cure Covid-19 than promote a 65-year-old drug that has proven to be effective throughout the world in curing the Wuhan virus. His purely political hatred of those who are promoting Hydroxychloroquine (HCQ) and Azithromycin smacks of monetary prerequisites of his approval. Despite the fact that his National Institute of Health approved HCQ in 2005 for Covid, his leftist politics refuse to admit that lives all over the world are saved by HCQ and Z-Pacs as so many physicians have testified to.

President Trump is hated for promoting HCQ and for taking it as a preventative, despite physicians who have said it works for both. Facebook, Google and Twitter have deleted the truth about HCQ. Even attorney Sidney Powell who retweeted President Trump’s tweet about HCQ was removed from twitter as was Donald Trump Jr. Free speech is a core of a free society. So, are we free? Not hardly.

Silencing truth.

Hydroxychloroquine

Doctors Back Trump

Physicians in America have taken a stand and are backing the president’s recommendation to use HCQ to treat Coronavirus. Across America doctors are standing behind the president and announcing that it’s time for America to reopen. A group of doctors standing before the Supreme Court building in Washington DC, claimed there is no reason to keep the country locked down when we already have a cure for the virus…Hydroxychloroquine. Dr. Simone Gold, an ER physician in Los Angeles for 20 years, who appeared with several other physicians said, “If you’ve gotten the virus, there is treatment and that’s what we’re here to tell you.” Dr. Gold said, “The American people aren’t hearing from all the experts across the country.

After this video aired and was viewed millions of times, Dr. Gold was summarily fired from her job. She has hired attorney L. Lin Wood to defend her.

Americans are being forced to take advice from doctors who have allowed their political bias against Donald Trump to stop them from treating patients they have the ability to cure. Of course, we’re speaking about the appointed head of the Coronavirus Task Force, VP Pence, whose chosen expert was Dr. Anthony Fauci.

(Koch Dark Money operative, Marc Short is Chief of Staff to VP Pence and he owns stocks that could conflict with Coronavirus response.)

Dr. James Todaro said, “If it seems like there’s an orchestrated attack against HCQ, it’s because there is. When have you ever heard of a medication generating this degree of controversy? HCQ is a 65-year-old medication that has been listed as the World Health Organization’s (WHO) safest medications for years and it’s over the counter in many countries. What we’re seeing is a lot of misinformation.” HCQ has been prescribed to hundreds of millions of people all over the world for over a half a century with no side effects. It has never been a controversial medicine until President Trump suggested it might be used to help Coronavirus patients and the Deep State went ballistic.

President Trump tweeted a copy of the doctors’ video which went viral with over 14 million views. Nigerian physician, Stella Immanuel is a primary care physician from Houston, Texas and her video alone reached 20 million on Facebook before it was removed.

Video Here: https://www.bitchute.com/video/pZV6XlNsG7av/

Twitter, Google, Facebook and other media giants rushed to delete all traces of these important videos from the internet. Dr. Simone Gold said,“Our website host, which is Squarespace, has just completely and arbitrarily shut down our website, claiming a violation of their terms of service. This is crazy. We are a group of doctors advocating for a better understanding of COVID-19 and its available treatment options. This is outrageous. We’re not subverting anything. We’re not purposely countering medical ethics. We’re not making anybody sick. We’re advocating for a better understanding of COVID-19. They take us down.”

Silencing truth.

Dr. Gold said, “We implore you to hear this because this message has been silenced. There are many thousands of physicians who have been silenced from telling the American people the good news about the situation, that we can manage the virus, carefully and intelligently, but we cannot live with this spiderweb of fear that is constricting our country.” She said that doctors are not being allowed to prescribe HCQ, and that if they do, the pharmacists can overrule the physician’s diagnosis and medications.

She is absolutely right, fear is what Fauci, Birx and Redfield have promoted and sold to the American public from the very beginning, and it appears to be purposeful. Dr. Fauci, WHO and the promoters of Remdesivir decided they wanted their drug to be the cureall for all patients of Covid. Why? Because they’d make beaucoup bucks off it, but it hasn’t proven to be nearly as effective as the older and cheaper HCQ.

Our economy is in shambles and democratic governors and mayors are purposely keeping businesses shut down because it’s an election year, and to hell with the people they represent.

The physicians all explained that Dr. Fauci is citing flawed studies and the negative reports on HCQ involve treating patients with lethal doses of the drug, something no physician should ever be doing. The physicians stated that Dr. Fauci has never treated a Covid-19 patient himself.

They added that with a cure like HCQ available, there is no need for social distancing, there’s no need for masks, there’s no need to keep our children home from school (other than keeping them from the common core and BLM rot) and there’s certainly no need to keep our country or the economy locked down.

Dr. Bob Hamilton stated that it was important for all people present during their talks that America’s children are not really the ones who are driving the infection; it is being driven by older individuals. He believes children can go back to school without fear. Dr. Hamilton stated, “There has not been one documented case of Covid being transferred from a student to a teacher in the world.” He explained that teachers’ unions are demanding conditions to return to school, some of which are totally outlandish and unrelated to the virus. In Los Angeles, California, the teacher’s union is demanding more money by defunding the police and calling for Medicare for all.

Doctors have warned that the effects of the lockdown are far worse than the virus, including a 600 percent increase in suicides.

The doctors said the biggest problem for them has been the government blocking doctors from treating patients they have the ability to cure right now. Dr. Hamilton said, “I think the important thing is we need to not act out of fear. We need to act out of science, we need to do it and get it done.”

Silencing truth.

George-Fareed

Saving Lives

Dr. George Fareed of El Centro, California, a 1970 honors graduate of Harvard, sent a letter to President Trump and the Task Force. He has used the HCQ, Azithromycin and Zinc cocktail to cure his patients and says it has kept them out of the hospital. He said, “Not only have I seen outstanding results with this approach, I have not seen any patient exhibit serious side-effects. To be clear — this drug has been used as an anti-malarial and to treat systemic lupus erythematosus as well as rheumatoid arthritis, and has over a 50-year track record for safety. It is shocking that it only now is being characterized as a dangerous drug.”

“Moreover, I am in my seventies, and I (as well as some other older physicians in the hospital) use hydroxychloroquine and zinc as prophylaxis. None of us have contracted the disease despite our high exposure to COVID patients nor have we experienced any side-effects.”

Hydroxychloroquine is the Key

It’s making a comeback from Lancet’s and Fauci’s false reports. Doctors all over the world are using it and their patients are recovering. When given early, not one patient dies, when taken as a prophylactic, it prevents physicians from contracting Covid from their patients. It’s cheap, it’s plentiful and it’s been around for over six decades, and Fauci and his gang don’t like it. Why? Because it’s all about money. The more money he can put in the pockets and his cohorts and himself, the happier he is, and to hell with the many lives that can be saved with the cheap drugs already available.

A Michigan hospital study says: “Treatment with Hydroxychloroquine Cut Death Rate Significantly in COVID-19 Patients. Treatment with HCQ cut the death rate significantly in sick patients hospitalized with Covid-19, and without heart-related side-effects, according to a new study published by Henry Ford Health System.

“Our analysis shows that using hydroxychloroquine helped saves lives,” said neurosurgeon Dr. Steven Kalkanis, CEO, Henry Ford Medical Group and Senior Vice President and Chief Academic Officer of Henry Ford Health System. “As doctors and scientists, we look to the data for insight. And the data here is clear that there was benefit to using the drug as a treatment for sick, hospitalized patients.”

So why the hatred of this life saving cocktail of drugs?

There are doctors all over the country, who are singing the praises of this drug, but there is a conspiracy of silence.The hydroxychloroquine cocktail, azithromycin, (Z-Pak) and zincwould solve some of the very basic problems that we’re now facing. It’s also a preventative. It would prevent hospitalizations. It keeps hospitals and ICUs from being overrun with Covid-19 patients, and it keeps patients off the deadly ventilators where 90% die after being on a ventilator long term. It apparently can be used early on in hospitalization to prevent patients from requiring ventilators, and reduces the length of a hospital stay.

Yet there’s literally no desire to use this cheap drug. America has lost 150,000 people to this flu-like virus. We lost so many during the H1N1 virus that we stopped counting, but we didn’t wear masks everywhere, we didn’t close schools, we didn’t keep six feet apart and we didn’t close the economy, yet more allegedly died in 2009-2010 under the Obama presidency than have died with this Wuhan virus under Donald Trump’s presidency.The CDC estimates that influenza has resulted in between 9 million to 45 million illnesses, between 140,000 to 810,000 hospitalizations and between 12,000 to 61,000 deaths annually since 2010, but we never donned masks.

Silencing truth.

Nursing Home Deaths

Governors of five states: Andrew Cuomo of New York, Gretchen Whitmer of Michigan, Gavin Newsom of California, Phil Murphy of New Jersey, and Tom Wolf of Pennsylvania put Covid patients in nursing homes and the virus spread rapidly to the elderly population with co-morbidities.

At least 62,000 residents and workers have died from the coronavirus at nursing homes and other long-term care facilities for older adults in the United States, according to a New York Times database. As of July 30, the virus has infected more than 362,000 people at some 16,000 facilities. Had they been given the cheap drug as a preventative, perhaps most of these older Americans would not have died alone.

Are these governors guilty of murder?

Conclusion

President Trump was lied to, our economy did not need to be shut down. Masks are to keep healthcare workers from contaminating open wounds of patients. They do little to prevent viruses. Healthy people are never quarantined. Distancing of six feet apart has no scientific authority whatsoever; it was born in a high school student’s science project. Had we remained open, and sheltered only the vulnerable, most likely we would have had her immunity within 40 to 70 days.

Thousands of Americans have died needlessly, which plays into the United Nations Agenda 2030 of decimating the world’s population. Yes, China is responsible, but more than China, the collateral damage to Americans from the shutdown is far greater than the damage done by the Wuhan virus. And that damage, which is still going on, was brought to us by Dr. Fauci, Dr. Birx, Dr. Redfield and the Democratic Party.

© 2020 Kelleigh Nelson – All Rights Reserved

E-Mail Kelleigh Nelson: proverbs133@bellsouth.net

print
Click Here for mass emailing

Share This Article
FacebookTwitterLinkedInRedditWhatsappGoogle+TumblrPinterestVkEmail
About the Author: Kelleigh Nelson

Kelleigh Nelson has been researching the Christian right and their connections to the left, the new age, and cults since 1975. Formerly an executive producer for three different national radio talk show hosts, she was adept at finding and scheduling a variety of wonderful guests for her radio hosts. She has owned her own wholesale commercial bakery since 1990. Previously, Kelleigh was marketing communications and advertising manager for a fortune 100 company. Born and raised in Chicago, Illinois, she was a Goldwater girl with high school classmate, Hillary Rodham, in Park Ridge, Illinois. Kelleigh is well acquainted with Chicago politics and was working in downtown Chicago during the 1968 Democratic convention riots. Email: Proverbs133@bellsouth.net

Lawyer’s sexual harassment was ‘monstrous and inhuman,’

sexharasssquare332pixels
sexual harassment concept with man and women (Image from Shutterstock.com)

Lawyer’s sexual harassment was ‘monstrous and inhuman,’ lawsuit alleges
By Debra Cassens Weiss
July 30, 2020, 2:07 pm CDT

A sexual harassment lawsuit filed against a Kentucky lawyer claims that he sexually harassed two employees with “outrageous and intolerable” conduct, leading one of them to threaten to cut off his exposed penis.

The lawsuit accuses Corbin, Kentucky, lawyer Shane Romines of fondling the employees, sending them “perverse and beyond obscene” videos of himself, and requiring one of them to perform oral sex. The plaintiffs are a former receptionist and legal assistant at the law firm.

The Louisville Courier Journal and the Times-Tribune have coverage; the Kentucky Trial Court Review’s Facebook page links to the July 28 complaint.

Romines denied the allegations, telling the Louisville Courier Journal that the claims “will prove to be untrue.”

The suit alleges that Romines allowed the receptionist to keep her $22,000-per-year job in exchange for his “monstrous and inhuman behaviors.”

Romines also made clear to the legal assistant that he expected her to “be friendly” and loyal if she expected to keep her job, according to the suit.

The legal assistant put up with Romines exposing himself until March 10, when he “flopped out his partially erect penis between her penholder and stapler and started shaking it, saying, ‘Just give it a little touch, c’mon, just a little touch,’” according the suit.

“Scared, shaken and physically ill, but at the end of her rope, [the employee] picked up her letter opener and said, ‘Or, like Lorena Bobbitt, I can cut it right off,’ ” the suit says.

After that, Romines stopped giving work to the legal assistant, “ghosted her and hired someone to replace her,” the suit says.

The two employees reached out to each other May 1 and learned that they were both victims, the suit says. They took sick leave and never returned. After the employees left, Romines called them each “a gold digger and slut,” according to the suit.

The suit alleges sexual harassment, retaliation, constructive discharge and infliction of emotional distress.

Romines is a personal injury lawyer with the Copeland & Romines Law Office. His uses the slogan “In pain? Call Shane!”

Victory: Missouri AG Intervenes to Drop Charges Against St. Louis Couple Who Fended off Mob With AR-15 — Jim Campbell’s

Comment by Jim Campbell July 30th, 2020 Never in their minds did it likely occur to this couple that they were violating the Second Amendment. They were fortunate, other states don’t have such lenient “Stand your ground legislation in their penal codes. It’s a safe bet they didn’t plan on having their video go viral […]

via Victory: Missouri AG Intervenes to Drop Charges Against St. Louis Couple Who Fended off Mob With AR-15 — Jim Campbell’s

DO NOT ALLOW BILL GATE’S WILL ON YOU!!! NEVER! — ARLIN REPORT……………….walking this path together

Gates isn’t looking for a cure…….he is looking for profit. Why would someone interested in depopulation be involved with an actual vaccine or prevention that saved lives? He wouldn’t, that is contrary to what he believes, a depopulation agenda! Would you jump off a cliff into water below filled with rocks and other unknown danger? […]

via DO NOT ALLOW BILL GATE’S WILL ON YOU!!! NEVER! — ARLIN REPORT……………….walking this path together

DeKalb County Passes Mask Ordinance to Stop the Spread of COVID-19

DeKalb County Passes Mask Ordinance to Stop the Spread of COVID-19
print
Tue, 07/21/2020 – 11:13 AM
Dekalb County

DECATUR, Ga. –Today, the DeKalb County Board of Commissioners approved CEO Michael Thurmond’s amendments to the mask ordinance commissioners passed July 14. The original mask ordinance was authored by Commissioner Mereda Davis Johnson.

“I would like to recognize and thank Commissioner Mereda Davis Johnson for her advocacy and leadership in encouraging DeKalb residents to wear masks to protect the community,” CEO Thurmond said.

The amended ordinance, which CEO Thurmond asserts is “consistent” with Gov. Brian Kemp’s executive order, requires DeKalb residents over age eight “to utilize a face covering or mask which covers the nose and mouth when in any public place.”

“We must do everything within our authority to stop the spread of this deadly virus,” CEO Thurmond said. “According to Centers for Disease Control and Prevention guidelines, wearing face coverings or masks, maintaining social distance and washing our hands frequently are the best ways to protect ourselves and the general public.”

The ordinance emphasizes the importance of community education and outreach. A written warning will be given for first violations. Those who violate the ordinance a second time will be required to attend a virtual or in-person COVID-19 prevention class “to understand the public health ramifications of this crisis and appropriate public health responses to mitigate the spread of this disease.”

Anyone who fails to attend the class will be fined $250.

Additionally, the DeKalb mask ordinance contains a unique “conscientious objector” clause that exempts any person from penalty who swears in a written affidavit to be presented in court, that they will not wear a mask for health-related, religious or ethical reasons.

The county will also distribute 20,000 masks to local brick-and-mortar small businesses which agree to implement a “No Mask, No Service” policy.
+++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++

WTF? The County Commissioners cannot make laws. The only ones that can make laws are the General Assembly Legislators.

So WTF, they are going to write us up, then they are going to make us go to re-education, and then they will charge $250?

Are you kidding me? The Demorats hard at work I see.

Sounds like a power game to me. No mask no service, is discriminating against people with health related issues. Sounds like violations of ADA, and Civil and Constitutional Rights to me.

I wonder how many lawsuits will spring up from these kinds of things.

James and I are virtual freelance legal assistants, if you need some assistance, holler.

The woke war on objectivity hits the federal judiciary by Jerome Marcus

sullivanflynn

The woke war on objectivity hits the federal judiciary
by Jerome Marcus | July 24, 2020 04:25 PM

https://www.washingtonexaminer.com/opinion/op-eds/the-woke-war-on-objectivity-hits-the-federal-judiciary

The Michael Flynn case has opened a new front in the woke war on objectivity: Within the federal judiciary, we now have judges taking sides in the cases before them. It’s a development directly at war with the political philosophy that animates our Constitution. It would, if left unchecked, destroy the neutrality of the federal courts. If that were to go, the judiciary’s legitimacy and public respect for its dictates would be destroyed.

When the Justice Department decided to agree with Flynn that his prosecution was unfounded and joined in his motion to dismiss the criminal charges against him, presiding Judge Emmet Sullivan refused. Instead, he appointed another lawyer, who had already gone on public record opposing dismissal, to “advise” the court whether Flynn should be prosecuted even after the prosecutor chose to end the case. The adviser later came through with a 70-page brief accusing the Justice Department of cronyism and corruption.

Flynn appealed, and the Court of Appeals held the judge had no authority to do anything other than what the prosecutor and the defendant had jointly agreed upon. He could not, the court held, take a side in the case or seek a resolution unwanted by either of the actual parties.

APP-121318-Emmet-G-Sullivan

Now, Sullivan has doubled down on his insistence that he need not be neutral: He has, as if he were a party to the case, filed a motion in the court of appeals asking that its decision be vacated and that the entire District of Columbia appellate bench rehears the matter. In so doing, he has dropped all pretense of neutrality and revealed his desire to steer the criminal case against Flynn, rather than presiding over it as a neutral figure who interprets and applies the law.

So why isn’t it the case that … if the government makes a considered but racist decision that it just does not want to have a white officer stand trial for excessive force on a black victim that the District Court can deny the motion and then the political chips can fall where they may, and perhaps under pressure from the public or Congress or whatever, the District Court may not be able itself to force government to prosecute the case that maybe through operation of the legislative branch or other pressures from the public and the media…a new prosecutor is appointed and the case proceeds?

Like Sullivan, the judge in Wilkins’s example is not a neutral decisor. He is on the political ramparts and inviting others to join him there.

How would this work in practice? A motion for dismissal of an indictment, under Federal Rule of Criminal Procedure 48(a), would be denied by a judge who distrusts the prosecutor and believes the decision to dismiss is animated by impermissible considerations. Many people now believe that virtually every decision made by the Trump administration is driven by racism. Perhaps the judge before whom our Rule 48(a) motion is pending is such a person. So the judge writes an opinion, denouncing the effort by the prosecution to dismiss the case and making whatever allegations about the prosecutor’s motivation the judge finds persuasive. The judge has life tenure after all; he can say whatever he wants. Such a ruling isn’t appealable. Then the fun starts.

“Pressure from the public” is brought to bear. “The media,” who may share the judge’s hostility to the prosecutor or the prosecutor’s boss (the president) do their part to amplify the judge’s allegations in newspaper stories, interviews, talk shows, and late-night monologues. Sympathetic members of Congress join the effort. Most importantly, an election is never too far away. Elections can produce a new president, and that’s how you get a new attorney general and then, as Wilkins says, “a new prosecutor.” According to this understanding of the federal courts’ role, the judge’s denunciation of the prosecutor is appropriately a part of that process, which will end when “the political chips fall where they may.” If the judge gets his way, “a new prosecutor is appointed, and the case proceeds.”

A judge who rules with the expectation that he can make “political chips fall” as a result of how he rules has crossed the clearest line there is distinguishing the federal courts from the other two branches.

It should hardly need explaining that judges don’t (they can’t) take sides from the bench in political disputes. They are neutral interpreters of the law; they aren’t parties to the case.

President Dwight Eisenhower was able to send the army to enforce Brown v. Board of Education, and so to integrate the schools in Little Rock, because the nation recognized that if the Supreme Court had decided the law required it, then the law required it. We had, and have, no choice as a country but to follow the law.

If the federal courts allow judges to become parties, no one will any longer believe that the judges are applying the law. They will be revealed as people trying to advance political goals. A nonelected body trying to advance political goals will not long be obeyed in a democracy.

There’s a simple way to put a stop to this: When the Court of Appeals denies (or better, dismisses) Sullivan’s petition for rehearing, it should reassign the case to a judge — an actual judge, who will be neutral. That would have to be someone other than Emmet Sullivan.

Jerome Marcus is an attorney in private practice and a former federal prosecutor.

==================================================================

Looks like the rest of the country gets to become familiar with the way normal people have been treated by the federal courts, and state courts alike for going on more than 20 years now.

And what was it that was said around 100 years ago now? In 1960, the ruling was already 30 years old so, yes, around 100 years ago…

It was in ELKINS v. UNITED STATES, 364 U.S. 206 (1960) 364 U.S. 206?? No. 126.
Argued March 28-29, 1960.   Decided June 27, 1960.

The Court, discussing the use of evidence illegally obtained by State Police, by federal prosecutors, and the FBI, and the Rights violations are discussed pretty heavily. Hell nowadays, the Courts do not give a second thought to violations of our civil and constitutional rights:

Elkins v. United States, 364 U.S. 206, 222-23 (1960) (“These, then, are the considerations of reason and experience which point to the rejection of a doctrine that would freely admit in a federal criminal trial evidence seized by state agents in violation of the defendant’s constitutional rights. But there is another consideration — the imperative of judicial integrity. It was of this that Mr. Justice Holmes and Mr. Justice Brandeis so eloquently spoke in Olmstead v. United States, 277 U.S. 438, at 469, 471, more than 30 years ago.
“For those who agree with me,” said Mr. Justice Holmes, “no distinction can be taken between the Government as prosecutor and the Government as judge.” 277 U.S., at 470. (Dissenting opinion.) “In a government of laws,” said Mr. Justice Brandeis, “existence of the government will be imperiled if it fails to observe the law scrupulously. Our Government is the potent, the omnipresent teacher. For good or for ill, it teaches the whole people by its example. Crime is contagious. If the Government becomes a lawbreaker, it breeds contempt for law; it invites every man to become a law unto himself; it invites anarchy. To declare that in the administration of the criminal law the end justifies the means — to declare that the Government may commit crimes in order to secure the conviction of a private criminal — would bring terrible retribution. Against that pernicious doctrine this Court should resolutely set its face.” 277 U.S., at 485. (Dissenting opinion.)”)

This basic principle was accepted by the Court in McNabb v. United States, 318 U.S. 332. There it was held that “a conviction resting on evidence secured through such a flagrant disregard of the procedure which Congress has commanded cannot be allowed to stand without making the courts themselves accomplices in willful disobedience of law.” 318 U.S., at 345. Even less should the federal courts be accomplices in the willful disobedience of a Constitution they are sworn to uphold.

For these reasons we hold that evidence obtained by state officers during a search which, if conducted by federal officers, would have violated the defendant’s immunity from unreasonable searches and seizures under the Fourth Amendment is inadmissible over the defendant’s timely objection in a federal criminal trial. In determining whether there has been an unreasonable search and seizure by state officers, a federal court must make an independent inquiry, whether or not there has been such an inquiry by a state court, and irrespective of how any such inquiry may have turned out. The test is one of federal law, neither enlarged by what one state court may have countenanced, nor diminished by what another may have colorably suppressed.

Elkins v. United States, 364 U.S. 206, 223-24 (1960)

Now think about the Flynn case, and numerous other cases, where the last thing the Courts think about, is if the evidence was illegally obtained, or if someone’s rights were violated in the illegal obtaining of the evidence.

We have no rights, and the many Courts’ flagrant disregard of the procedure
which Congress had commanded cannot stand…

All I can wonder is what the fuck?

There Is No Science to Support Mandatory Face Masks. A Symbol of Social Submission?

image

There Is No Science to Support Mandatory Face Masks. A Symbol of Social Submission?
By Renee Parsons
Global Research, July 22, 2020

There Is No Science to Support Mandatory Face Masks. A Symbol of Social Submission?

As the distraction of BLM/Antifa riots and the coronavirus have consumed much attention and energy, the social engineering agenda of the World Economic Forum’s Great Reset has taken a giant step forward in establishing the mandatory face mask as a symbol of submission to their dehumanizing agenda. Beyond Orwellian, the face mask is being used as a guise to re shape our perception of reality in acceptance of a scientific dictatorship as an integral part of a looming totalitarian globalist agenda.

As Democratic Governors have played a leading role in advancing the myth that face masks will save lives, Colorado Gov Jared Polis announced his decision on July 16th to mandate face masks to be worn in all public places in Colorado; thus codifying a medical tyranny world view.

In a July 12th Facebook page, Polis stated that “The emerging scientific data is clear” that wearing a mask protects others and reduces the risk of contracting Coronavirus. Polis then referred to those resistant to a face mask as a “selfish bastard.”

During Polis’s four page Executive Order issued on July 19th, there is not one mention of the ‘emerging science’ as support for his decision to mandate face masks; nor does Polis discuss how health effects will improve with masking except as “mitigating effects of the pandemic.” In announcing the mandate, Polis declared that “Wearing a mask is not a political statement. I don’t know how, in anybody’s mind, this became a game of political football.”

If the Governor is truly at a loss as to how masking or other lockdown requirements became a political football, he has not been paying attention. Consider the following: on March 20th, California became the first state in the country to order a Lockdown which was quickly followed by other States with Democratic Governors. To date, a majority of those Governors (21 out of 24) have all approved the mandatory wearing of face masks, albeit without applying any science. It is the arbitrary ‘shutdown’ of business as well as onerous personal requirements (such as social distancing) with a State adopting oppressive dictatorial behavior as if they have the right to make personal decisions about any one life.

Only four states with Republican Governors, some of which may be considered RINOs, have also adopted similar Executive Orders (Alabama, Arkansas, Massachusetts, Maryland).

*

If CV is merely a variation of an infectious virus, sunshine and warm weather should have already limited its impact; reducing its spread and exposure. Instead, as Red States attempt to re open (ie Texas and Florida), sudden intense CV ‘hot spots’ flare which forces the State to delay and increase its shut down requirements. Given an advanced radio frequency weapon ability, those ‘hot spots’ may have been generated by 5G at the millimeter level on the electro magnetic Spectrum.
Fashion Fetishism, Surgical Masks and Coronavirus

If, in fact, science is not the prime reason for mandatory face masks; that is, if face masks do not provide safety from contagion, then why mandate face masks at all? What other purpose does a face mask have but to protect the wearer or to inhibit spreading the virus? Without evidence that masks have positively reduced exposures and thereby fatalities, then the true purpose of the mandate becomes a more nefarious political and partisan gesture of psychological manipulation and control.

New England Journal of Medicine

On April 1st the prestigious New England Journal of Medicine published its Universal Masking Report including the following highlights:

“We know that wearing a mask outside health care facilities offers little, if any, protection from infection.”
“The chance of catching Covid-19 from a passing interaction in a public space is therefore minimal.”
“In many cases, the desire for widespread masking is a reflexive reaction to anxiety over the pandemic.”
“The extent of marginal benefit of universal masking over and above these foundational measures is debatable.“
“What is clear, however, is that universal masking alone is not a panacea.”
“It is also clear that masks serve symbolic roles. Masks are not only tools, they are also talismans that may help increase health care workers’ perceived sense of safety, well-being, and trust in their hospitals. Although such reactions may not be strictly logical, we are all subject to fear and anxiety, especially during times of crisis. One might argue that fear and anxiety are better countered with data and education than with a marginally beneficial mask“

No Scientific Support for Mask Wearing

Renowned nutritionist Dr. Joseph Mercola has recently reversed his earlier support of face masks and interviewed Dr. Denis Rancourt, PhD who examined the issue on behalf of the Ontario Civil Liberties Association. Rancourt conducted extensive research with an emphasis on masks and did a thorough review of science literature concentrating on whether any evidence exists that masks can reduce infection risk of viral respiratory disease. As a result of examining many controlled trials with verified outcomes, he found no statistical advantage to wearing a mask or not wearing a mask and that masks do no inhibit viral spread.

Rancourt asserted that “there is no evidence that masks are of any utility for preventing infection by either stopping the aerosol particles from coming out, or from going in. You’re not helping the people around you by wearing a mask, and you’re not helping yourself avoid the disease by wearing a mask. In addition, Rancourt explained that “Infectious viral respiratory diseases primarily spread via very fine aerosol particles that are in suspension in the air. Any mask that allows you to breathe therefore allows for transmission of aerosolized viruses.”

In conclusion, Rancourt stated

“we’re in a state right now where the society is very gradually evolving towards totalitarianism.  As soon as you agree with an irrational order, an irrational command that is not science-based, then you are doing nothing to bring back society towards the free and democratic society that we should have.”

While the ACLU remains absent, OCLA (Ontario Civil Liberties Association) recommends Civil Disobedience against Mandatory Mask Laws. If you are not comfortable with civil disobedience and your local food markets all require a face mask, don’t deny yourself the healthy food you and your family need – but DO find ways to register your dissent against being forced to wear a face mask. Write a Letter to the Editor and contact all of your elected political leaders. Be sure they understand your objections that you will not comply with their unconstitutional and immoral behavior.

*

Note to readers: please click the share buttons above or below. Forward this article to your email lists. Crosspost on your blog site, internet forums. etc.

Renee Parsons served on the ACLU’s Florida State Board of Directors and as president of the ACLU Treasure Coast Chapter. She has been an elected public official in Colorado, an environmental lobbyist for Friends of the Earth and a staff member of the US House of Representatives in Washington DC. She can be found at reneedove3@yahoo.com.

Featured image: A woman wearing a face mask is seen in the subway in Milan, Italy, March 2, 2020. (Photo by Daniele Mascolo/Xinhua)
The original source of this article is Global Research
Copyright © Renee Parsons, Global Research, 2020

Comment on Global Research Articles on our Facebook page

Become a Member of Global Research
Related Articles
Unintended Consequences: Facemasks and Rising Crime in the US
Jul 12, 2020
Face Masks Pose Serious Risks to the Healthy
May 25, 2020
Unmasking the Truth: Studies Show Dehumanizing Masks Weaken You and Don’t Protect You
May 20, 2020
Fashion Fetishism, Surgical Masks and Coronavirus
Feb 13, 2020

US authorities uncover massive, nationwide weapons trafficking ring run by communist China to arm Black Lives Matter terrorists with powerful weapons of war

Terrorist-Machine-Gun-Rifle
Image: US authorities uncover massive, nationwide weapons trafficking ring run by communist China to arm Black Lives Matter terrorists with powerful weapons of war

US authorities uncover massive, nationwide weapons trafficking ring run by communist China to arm Black Lives Matter terrorists with powerful weapons of war
Wednesday, July 15, 2020 by: Mike Adams
https://www.naturalnews.com/2020-07-15-us-authorities-uncover-nationwide-weapons-trafficking-ring-china-black-lives-matter.html

(Natural News) On July 3rd of this year, Natural News reported that communist China was trafficking full-auto weapons parts into Florida as a way to arm Black Lives Matter terrorists in advance of a planned armed uprising / revolution. US Customs and Border Protection (CBP) had interdicted and seized a shipment of over 10,000 full-auto upgrade parts that convert semi-auto rifles into full-auto weapons of war.

According to the CBP announcement from June 26th, the shipment originated in Shenzhen, China and was destined for “a residence” in Melbourne, Florida. Inside the shipment was over 10,000 small machine parts that function as full-auto drop-in upgrades for AR-15s. Natural News was able to determine that this operation was part of an attempt by communist China to destabilize the United States by arming Antifa and Black Lives Matter terrorists.
CBP-china-seized-automatic-weapons-parts

Now, US Immigration and Customs Enforcement (ICE) officials have seized an operation in Detroit that smuggle suppressors (silencers) into the United States from China, also for the purpose of arming Black Lives Matter militant extremists. As reported by The National Pulse:

Immigration and Customs Enforcement (ICE) officials on Detroit’s Homeland Security Investigations (HSI) team took over the China-operated domain “http://lafoauto.com/” as part of an international arms-trafficking investigation.

The team determined “more than 350 suppressors seized by law enforcement across the county were purchased from the website and smuggled into the United States from China as automotive parts.”

The entire website was reportedly operated by China, and its purpose was to arm Black Lives Matter terrorists who are working with communist / Marxist forces in the United States to overthrow the government and nullify the Constitution. As The National Pulse explains:

The July 13th announcement also casts a report from the Wall Street Journal noting the appearance of illegal firearms and accessories appearing around Black Lives Matter (BLM) protests across the country in a curious – and perhaps foreign – light.

The article documents the sharp increase in the number of guns being carried into protests by Black Lives Matter extremists.

The National Pulse also documents how “11,000 assault weapons parts” have recently been caught during an attempt to smuggle them into Louisville, Kentucky. The origin of the parts? Shenzen, China.

China weapons smuggling now confirmed in three U.S. cities… with more to be uncovered
There’s now no question that China is actively working to destabilize the United States of America in a multitude of ways, including working with Mexican drug cartels to smuggling heroin and fentanyl into the U.S., killing over 50,000 mostly military-aged young men in America each year. This is a deliberate chemical weapons attack on the United States.

At the same time, China is bribing U.S. officials, including family members of Joe Biden who have received millions of dollars from Chinese corporations. China is also engaged in multi-billion dollar money laundering operations for California Governor Newsom who is running an elaborate taxpayer-funded embezzling operation that funnels billions of dollars of public money into Chinese corporations which launder the money and transfer a portion back to Newsom, under the control of his shell corporation front companies.

Now, we know that China is also smuggling military-grade weapons parts into the United States and even running online retail websites to sell and distribute those parts to anti-American forces such as Antifa and Black Lives Matter. Importantly, Black Lives Matter is a domestic terrorism organization that was founded in part by a convicted terrorist named Susan Rosenberg, who took part in the plotting of bombing government buildings.

BLM-China-Gun-Map-600

Now, it seems that Black Lives Matter is not only being financially supported by hundreds of U.S. corporations that are bowing down to the terrorists as some twisted form of virtue signaling; even communist China is now supplying weapons to the group in the hope that BLM might succeed in overthrowing the U.S. government and eliminating President Trump, who has declared an end to China’s exploitation of America’s weaknesses under Obama, Biden, Clinton and other traitors.

When the civil war begins, patriots will be facing extremely well-armed Black Lives Matter militant extremists
The upshot of this is that once the civil war uprising is activated by Black Lives Matter — which will likely happen by November at the latest — armed American citizens (who typically own only semi-auto firearms) will be facing off against Black Lives Matter and Antifa terrorists who have full-auto weapons upgrades and suppressors, allowing them to operate more effectively at night as they try to pull off assassinations and the mass murder of Christians, White people, Trump supporters and conservatives.

On top of that, separate intel sources have told Natural News that Black Lives Matter groups are stealing armored personnel carriers from National Guard bases and law enforcement agencies in certain U.S. cities. Quite literally, these armored vehicles are “disappearing” from the inventory of National Guard bases, and it turns out that anti-America traitors are working from inside the National Guard in liberal states like California to steal these high-end, armored vehicles that can be used to rapidly deploy BLM militant troops.

Remember when Obama said that he wanted a “civilian army” that would be just as strong and powerful as the U.S. military? His loyalists are quite literally building that civilian army, and they’re doing it with the help of communist China and traitors inside the National Guard.

When the full revolution is ignited, heavily-armed Leftists — who are carrying the very same “weapons of war” they claim to want banned from civilian ownership — will descend on the homes of local Republican leaders, police officers, sheriff’s deputies and notable conservative commentators, and they will be given order to execute those targets. Make no mistake: This will include people like Sean Hannity, Mark Levin and Tucker Carlson. It will also include alternative media personalities like Dave Hodges, Alex Jones, Steve Quayle and even myself. This is why I have urged my colleagues to get fully prepared with battle rifle training, night vision gear (ReadyMadeResources.com), chest rigs and expanding tip ammo (“Controlled Chaos”). It also doesn’t hurt to have guard dogs and perimeter alert systems in place, among other tactics.

Prepare with a new FREE audio book that we’re about to launch in the next two weeks: The “Global Reset Survival Guide”
I’ve recorded a nearly nine-hour audio book called The Global Reset Survival Guide. This will be a full, FREE download from NaturalNews.com, including a PDF document and raw .mp3 files that you can listen to on any device.

This download will be exclusive to NaturalNews.com email newsletter subscribers, so if you’re not already subscribed, sign up at this link (it’s free). You’ll be alerted when this download becomes available (soon).

The-Global-Reset-Survival-Guide-450

This Global Reset Survival Guide teaches you a wealth of lifesaving information about how to deal with the coming Global Reset, including:

Exactly what tactical gear you’ll need in order to be ready for the kinetic civil war, including specific firearms, red dot sights, chest rigs, communications gear and more.
How to protect your assets and savings from the coming global financial reset which will destroy the value of the U.S. dollar and most fiat currencies.
Why you must get out of Democrat-controlled cities, and how to choose a rural bugout location.
How the food collapse will take place, and why as much as 90% of the current human population will be wiped out if the globalists get their way.
How to survive without electricity / preparing for the power grid to go down and stay down for an extended period of time.
How to hide supplies so you can survive a FEMA raid on your property. FEMA will confiscate your food, ammunition, firearms and cash.
With nearly nine hours of audio book content, this free download is a lifesaving collection of knowledge that you absolutely won’t want to miss. Watch for the announcement on NaturalNews.com within the next 14 days.

Missouri couple’s gun rights defended in letter to AG Barr from 12 GOP lawmakers A second weapon from Mark and Patricia McCloskey was surrendered to authorities Saturday By Dom Calicchio | Fox News

image

I personally can’t believe that the authorities have taken these people’s guns, and did it on tv, showing that they are now unarmed! The cops showed up with a search warrant! What is going to protect these people now that the clowns that broke their gate and entered their property, know that they are unarmed?

Missouri couple’s gun rights defended in letter to AG Barr from 12 GOP lawmakers
A second weapon from Mark and Patricia McCloskey was surrendered to authorities Saturday
By Dom Calicchio | Fox News
https://www.foxnews.com/us/missouri-couples-gun-rights-defended-in-letter-to-ag-barr-from-12-gop-lawmakers

Reports: St. Louis police execute search warrant, seize rifle from Mark and Patricia McCloskey

Twelve Republican members of Congress have written to U.S. Attorney General William Barr, arguing in defense of the Second Amendment rights of a Missouri couple whose rifle and handgun are now in the possession of local authorities.

Mark and Patricia McCloskey, who made national headlines in late June when they took up arms to defend their home from protesters who stormed into their gated St. Louis neighborhood, had their rifle seized Friday when local police executed a search warrant.

Then on Saturday, a lawyer — who represented the couple until recently – surrendered to police a handgun that Patricia McCloskey held during the June incident, FOX 2 of St. Louis reported.

MISSOURI COUPLE WHO DEFENDED HOME HAVE RIFLE SEIZED DURING POLICE SEARCH: REPORT

Attorney Al Watkins said he had taken possession of the handgun while still representing the couple, in anticipation of using it as evidence in a possible court appearance, FOX 2 reported.

“It was my duty and obligation to make sure that evidence was preserved to maintain the integrity of the defense of Mr. and/or Mrs. McCloskey in the event, in what I believe the highly unlikely event, of any charges being brought,” Watkins said, according to KSDK-TV of St. Louis.

"It was my duty and obligation to make sure that evidence was preserved to maintain the integrity of the defense of Mr. and/or Mrs. McCloskey."
— Al Watkins, attorney

Watkins said the gun was “inoperable” prior to the June incident, and Patricia McCloskey knew it was inoperable. But he said there were some potential legal issues with the way Patricia McCloskey held her weapon versus the way Mark McCloskey held his, making the weapon’s condition an issue, KSDK reported.

Since the June incident, the McCloskeys have faced scrutiny from the St. Louis Police Department and from the city’s circuit attorney, Kimberly Gardner, who have been investigating the incident – but there was no indication the couple were facing any charges.

In a statement June 29, Gardner wrote that protesters had First Amendment rights that needed to be protected from “intimidation or threat of deadly force,” and said any such behavior would “not be tolerated.”

Rights threatened ‘by mob rule’

In their letter to Barr, dated Friday, the dozen Republican lawmakers claimed that any charges filed against the couple would have “a chilling effect” on an American populace whose rights to bear arms are guaranteed in the Second Amendment of the U.S. Constitution.

“At this crucial time in history, our nation needs the Department of Justice to exert strong leadership to ensure that none of our constitutional protections are eroded by mob rule,” the lawmakers wrote in part to Barr. “Charges against this couple will have a chilling effect on the entire nation, sending the message that American citizens no longer have the right to protect themselves at their own homes.”

“Charges against this couple will have a chilling effect on the entire nation, sending the message that American citizens no longer have the right to protect themselves at their own homes.”
— Letter to AG Barr from 12 GOP lawmakers

Signing the letter were U.S. Reps. Louis Gohmert of Texas; Mo Brooks of Alabama; Greg Steube of Florida; Brian Babin of Texas; Paul Gosar of Arizona; Alex Mooney of West Virginia; Andy Harris of Maryland; Ted Budd of North Carolina; Steve King of Iowa; Steve Watkins of Kansas; Jody Hice of Georgia; and Scott Perry of Pennsylvania.

Saturday’s handover of the pistol occurred outside Watkins’ St. Louis office, in full view of reporters and bystanders, who watched and took photos. Some photos appeared on the website of FOX 2 of St. Louis.

Watkins said he was no longer representing the McCloskeys because his decision to hold the couple’s handgun in his office had made him a potential witness in any court case involving the couple, KSDK reported. The couple’s new lawyer is Joel Schwartz.
Mark and Patricia McCloskey are seen outside their St. Louis home in a clash with protesters, June 28, 2020. (Getty Images)

Mark and Patricia McCloskey are seen outside their St. Louis home in a clash with protesters, June 28, 2020. (Getty Images)

Authorities wanted the handgun in their possession to be sure it was inoperable as the McCloskeys and Watkins have claimed, FOX 2 reported. The reason for the rifle being confiscated on Friday remained unclear.

The protesters claimed they marched past the McCloskeys’ home on the way to a planned gathering outside the home of St. Louis Mayor Lyda Krewson.

Schwartz, the couple’s new lawyer, told KSDK on Friday that he does not believe the McCloskeys will face any charges in connection with the June incident, and said he is trying to arrange a meeting with the office of Gardner, the circuit attorney.

If they do face charges and are convicted, they would likely get probation or be required to perform community service, a law professor at St. Louis University told KSDK.

“There’s very little likelihood that the McCloskeys would see any jail time or prison time on these kind of charges,” Professor John Ammann told the station.
Dom Calicchio is a Senior Editor at FoxNews.com. Reach him at dom.calicchio@foxnews.com.

That is ridiculous, not only are the disarmed, but their chicken shit lawyer has bailed on them too. What a brave man! NOT

STUNNING: Fauci’s Remdesivir Costs $9 Per Dose, Will Be Sold at $3,000 per Treatment — China Company Linked to Soros Will Also Mass Produce the Drug

coronavirus-5
By Jim Hoft
Published June 29, 2020 at 11:31am
https://www.thegatewaypundit.com/2020/06/stunning-faucis-remdesivir-costs-9-per-dose-will-sold-3000-per-dose-china-company-linked-soros-will-also-mass-produce-

The Association of American Physicians and Surgeons (https://aapsonline.org) filed a lawsuit against Department of Health and Human Services and the FDA for “irrational interference” by the FDA with timely access to hydroxychloroquine.

Never in history have we seen such a determined effort by the scientific community and pharmaceutical industry to downplay and lie about the use of a successful drug to treat a deadly disease.

Hydroxychloroquine is the first choice in a study of 6,000 doctors treating the coronavirus.
In the field and in independent testing hydroxychloroquine displayed amazing results in treating the COVID-19 virus.

But there was great pushback against hydroxychloroquine for two reasons. The first reason was because it was safe and very inexpensive. The second reason is because Donald Trump promoted its use.

Video at: https://www.thegatewaypundit.com/2020/06/stunning-faucis-remdesivir-costs-9-per-dose-will-sold-3000-per-dose-china-company-linked-soros-will-also-mass-produce-drug/

Share
Tweet
P Share
Email
Print
STUNNING: Fauci’s Remdesivir Costs $9 Per Dose, Will Be Sold at $3,000 per Treatment — China Company Linked to Soros Will Also Mass Produce the Drug
By Jim Hoft
Published June 29, 2020 at 11:31am
412 Comments
Share (7.4k)
Tweet
P Share
Email

The Association of American Physicians and Surgeons (https://aapsonline.org) filed a lawsuit against Department of Health and Human Services and the FDA for “irrational interference” by the FDA with timely access to hydroxychloroquine.

Never in history have we seen such a determined effort by the scientific community and pharmaceutical industry to downplay and lie about the use of a successful drug to treat a deadly disease.

Advertisement – story continues below

Hydroxychloroquine is the first choice in a study of 6,000 doctors treating the coronavirus.
In the field and in independent testing hydroxychloroquine displayed amazing results in treating the COVID-19 virus.

But there was great pushback against hydroxychloroquine for two reasons. The first reason was because it was safe and very inexpensive. The second reason is because Donald Trump promoted its use.

It is not a stretch to say the Democrat establishment would rather see people die than see President Trump be proven right.

As we reported earlier from the beginning Dr. Fauci was against the use of hydroxychloroquine as a treatment for coronavirus. Fauci was thrilled about its use just a few years ago.

Dr. Fauci did promote the use of remdesivir. He was excited to share the news on its effectiveness in April.

Gilead, the company that produces remdesivir, is a large company that spends millions in its lobbying efforts annually:

Gilead-Lobbying-600x318

Gilead is also connected to Wuxi AppTec and George Soros according to WND:

And just who, or what is Gilead Sciences? Gilead is partnered with Wuxi AppTec, an international pharmaceutical, biopharmaceutical and medical device company. According to Wikipedia, “The company covers the development cycle through five core operations, including small molecule R&D and manufacturing, biologics R&D and manufacturing, cell therapy and gene therapy R&D and manufacturing, medical device testing, and molecular testing and genomics.” And where, you may ask, is the company located? Wuxi AppTec was begun in Shanghai by Dr. Gi Li now with facilities also in Wuxi City and Suzhou, China, as well as facilities in St. Paul, Minnesota, Philadelphia and Atlanta. Wuxi AppTec is owned in part by none other than America’s own – George Soros.

We reported earlier, that the China coronavirus was connected to the above players and to China’s Communist Party:

China-Coronavirus-Connections

In addition, WND reports Gilead is linked to UNITAID:

Holding this web together is the fact that Gilead has endorsed and is engaged with a drug purchasing group, UNITAID. UNITAID is an outgrowth of the United Nations, Millennium Declaration of 2000, which is now the U.N. Global Compact.

The large investors in UNITAID include WHO, George Soros, the Bill and Melinda Gates Foundation and a partnership relationship with the Clinton Health Access Initiative. Both Drs. Fauci and Birx are associated with the Clinton Health Access Initiative.

The one person behind the promotion of Gilead’s remdesivir is the doctor who has worked with Gilead for a long time, Dr. Fauci. He also has downplayed and criticized the use of the much cheaper drug hydroxychloroquine:

Can there be any uncertainty as to why Dr. Fauci, who worked closely with Gilead, is strongly promoting its more expensive and less effective medication, which has already failed against Ebola, over a readily available, markedly affordable medication with a 91% success rate?

Today Pharmaceutical giant Gilead announced the pricing for its coronavirus drug remdesivir.

Gilead said the drug will cost $520 per vial, or $3,120 for a six-vial treatment.

A previous report at Bloomberg noted the cost to manufacture remdesivir is only $9 per treatment.
Hydroxychloroquine is only $1 per treatment!

chart-2-653x479

China started mass producing the drug back in February. They want to cash in on the profits too.

How long has the production of remdesivir been in the planning? Why is this drug so highly touted by Dr. Fauci? And what about the outrageous profit margin?

This should be investigated.
Hat tip Marty

Outrage! Environmental Court seizes people’s homes based on ‘hearsay’ — Jim Campbell’s

Comment by Jim Campbell November 5th, 2020 So much for Due Process and the 14th Amendment. What about “Too The Republic For Which it Stands. No sworn witnesses, no authenticated evidence, no transcribed proceedings, files destroyed By WND Staff Published July 5th, 2020 There are no transcribed proceeding notes, and some files apparently have been […]

via Outrage! Environmental Court seizes people’s homes based on ‘hearsay’ — Jim Campbell’s

Outrage! Environmental Court seizes people’s homes based on ‘hearsay’ — Jim Campbell’s

Comment by Jim Campbell November 5th, 2020 So much for Due Process and the 14th Amendment. What about “Too The Republic For Which it Stands. No sworn witnesses, no authenticated evidence, no transcribed proceedings, files destroyed By WND Staff Published July 5th, 2020 There are no transcribed proceeding notes, and some files apparently have been […]

via Outrage! Environmental Court seizes people’s homes based on ‘hearsay’ — Jim Campbell’s

Prominent Baltimore defense lawyer indicted for allegedly aiding crimes of marijuana kingpin By Debra Cassens Weiss

marijuana-gavel
(Image Shutterstock)

Prominent Baltimore defense lawyer indicted for allegedly aiding crimes of marijuana kingpin
By Debra Cassens Weiss
September 20, 2019, 10:50 am CDT
https://www.abajournal.com/news/article/prominent-baltimore-defense-lawyer-indicted-for-allegedly-aiding-crimes-of-marijuana-kingpin

Prominent Baltimore defense lawyer Ken Ravenell has been indicted on federal charges based on allegations he helped a Jamaican marijuana kingpin and his crew members launder drug proceeds and avoid detection.

The indictment returned Wednesday charges Ravenell, 60, with racketeering conspiracy, conspiracy to commit money laundering, and narcotics conspiracy, according to the Baltimore Sun and a press release.

The indictment alleges Ravenell instructed crew members to “utilize certain drug couriers, to utilize specific modes of transportation and to transport shipments of drugs and money at particular times of day, all for the purpose of evading law enforcement.”

The indictment also claims Ravenell told crew members they should use payphones and prepaid phones, and should remove batteries from their phones when meeting to discuss illegal activities.

Prosecutors say Ravenell used the law firm where he was a partner in furtherance of the conspiracy, which took place between 2009 and 2014.

Some of the drug crew’s meetings were held at the law firm, and Ravenell used law firm bank accounts to launder drug money and pay lawyers representing other members of the conspiracy, according to the indictment.

Prosecutors also say Ravenell found lawyers who refused to represent cooperating witnesses to represent crew members, and required the crew members to sign retainer agreements that allowed their lawyers to withdraw from the case if the client tried to cooperate.

Ravenell obtained information about the status of the cases and whether the defendants were cooperating, and then relayed that information to other conspirators, prosecutors say. Ravenell also met with defendants in jail without permission of their lawyers and encouraged them to accept plea deals that did not include cooperation, according to the indictment.

The Baltimore Sun identified Ravenell’s former firm as the Murphy Law Firm. Since leaving the firm, Ravenell has emerged as a top defense lawyer who has handled high-profile murder cases, according to the Sun.